method for making antibody and method for selecting a human heavy chain variable region nucleic acid

专利摘要:
METHODS OF PRODUCING A MOUSE AND SELECTING A HUMAN HEAVY CHAIN VARIABLE REGION FOR THE PRODUCTION OF AN ANTIGEN-BINDING PROTEIN, AS WELL AS USE OF A GENETICALLY MODIFIED MOUSE IN THE PRODUCTION OF A HYME AND ANTIGEN-BINDING PROTEIN. The present invention relates to a genetically modified mouse, in which the mouse is incapable of rearrangement and expression of an endogenous mouse immunoglobulin light chain variable sequence, in which the mouse expresses only one or two human light chain variable domains encoded by human immunoglobulin sequences operatively linked to the mouse constant kappa (?) gene at the endogenous mouse locus ?, in which the mouse expresses a reverse chimeric antibody having a light chain variable domain derived from one of only two gene segments of the region human light chain variable and a constant domain ? from mouse, and a human heavy chain variable domain and a mouse heavy chain constant domain, from an endogenous mouse heavy chain locus. Bispecific epitope-binding proteins that are fully human are provided, comprising two different heavy chains that associate with an identical light chain (...).
公开号:BR112012019887B1
申请号:R112012019887-4
申请日:2011-02-08
公开日:2021-06-08
发明作者:Lynn MacDonald；Sean Stevens；Samuel Davis；Andrew J. Murphy；David R. Buckler；John McWhirter
申请人:Regeneron Pharmaceuticals, Inc；
IPC主号:

专利说明:

FIELD OF THE INVENTION
[0001] The present invention relates to a genetically modified mouse is provided that expresses antibodies having a common human/mouse constant variable light chain associated with several human/mouse constant variable heavy chains. A method for producing a human bispecific antibody from mouse B cell human variable region gene sequences is provided. BACKGROUND
Antibodies typically comprise a homodimeric heavy chain component, in which each heavy chain monomer is associated with an identical light chain. Antibodies having a heterodimeric heavy chain component (for example, bispecific antibodies) are desirable as therapeutic antibodies. But producing bispecific antibodies having a suitable light chain component that can satisfactorily associate with each of the heavy chains of a bispecific antibody has proved problematic.
[0003] In one approach, a light chain could be selected by statistical survey of the use of all variable domains of the light chain, identifying the light chain even more frequently used in human antibodies, and pairing that light chain in vitro with two heavy chains of different specificity.
[0004] In another approach, a light chain could be selected by looking at light chain sequences in a phage display library (for example a phage display library comprising human light chain variable region sequences, for example a library human scFv) and selecting the even more commonly used light chain variable region from the library. The light chain can then be tested on two different heavy chains of interest.
[0005] In another approach, a light chain could be selected by analyzing a phage display library of light chain variable sequences using the heavy chain variable sequences of both heavy chains of interest as probes. A light chain that associates with both heavy chain variable sequences could be selected as a heavy chain light chain.
[0006] In another approach, a candidate light chain could be aligned with the cognate light chains of the heavy chains, and modifications are made to the light chain to more closely match with sequence characteristics common to the cognate light chains of both heavy chains. If the possibilities of immunogenicity are to be minimized, the modifications preferably result in sequences that are present in known human light chain sequences, such that proteolytic processing is unlikely to generate a T cell epitope based on parameters and methods known in the art to evaluate the probability of immunogenicity (ie, in silico as well as wet assays).
[0007] All of the above approaches depend on in vitro methods that group together several a priori constraints, for example, sequence identity, ability to associate with specific pre-selected heavy chains, etc. There is a need in the art for compositions and methods that do not rely on manipulation of in vitro conditions, but instead employ more biologically reasonable approaches to producing human epitope binding proteins that include a common light chain. BRIEF DESCRIPTION OF THE FIGURES
[0008] Figure 1 illustrates a targeting strategy to replace endogenous mouse immunoglobulin light chain variable region gene segments with a human VK1-39JK5 gene region.
[0009] Figure 2 illustrates a targeting strategy to replace endogenous mouse immunoglobulin light chain variable region gene segments with a human VK3-20JK1 gene region.
[00010] Figure 3 illustrates a targeting strategy to replace endogenous mouse immunoglobulin light chain variable region gene segments with a human VpreB/JÀ5 gene region. SUMMARY
[00011] Genetically modified mice expressing human immunoglobulin heavy and light chain variable domains, in which mice have a limited light chain variable repertoire, are provided. A biological system for generating a human light chain variable domain that associates and expresses with a diverse repertoire of affinity matured human heavy chain variable domains is provided. Methods for producing binding proteins comprising immunoglobulin variable domains are provided, comprising immunizing mice that have a limited immunoglobulin light chain repertoire with an antigen of interest, and employing a mouse immunoglobulin variable region gene sequence in a binding protein that specifically binds to the antigen of interest. The methods include methods for producing human immunoglobulin heavy chain variable domains suitable for use in creating multispecific antigen binding proteins.
[00012] Genetically engineered mice are provided with suitable affinity-matured human immunoglobulin heavy chain variable domains derived from a repertoire of unrearranged human heavy chain variable region gene segments, in which associated affinity-matured human heavy chain variable domains and expressed with a single human light chain variable domain derived from a human light chain variable region gene segment. Genetically bred mice that have a choice of two human light chain variable region gene segments are also provided.
[00013] Genetically engineered mice are provided to express a limited repertoire of human light chain variable domains, or single human light chain variable domain, from a limited repertoire of human light chain variable region gene segments. Mice are genetically engineered to include a single unrearranged human light chain variable region gene segment (or two human light chain variable region gene segments) that rearranges to form a rearranged human light chain variable region gene (or two rearranged light chain variable region genes) that express a single light chain (or that express one or both of two light chains). The rearranged human light chain variable domains are capable of pairing with a plurality of mouse-selected affinity-matured human heavy chains, wherein the heavy chain variable regions specifically bind to different epitopes.
[00014] In one aspect, a genetically engineered mouse is provided to comprise a single human immunoglobulin light chain variable region (VL) gene segment that is capable of rearranging and encoding a human VL domain of an immunoglobulin light chain . In another aspect, the mouse comprises no more than two human VL gene segments that are capable of rearranging and encoding a human VL domain of an immunoglobulin light chain.
[00015] In one aspect, a genetically modified mouse is provided to comprise a single rearranged variable region (VL) segment (V/J) of the human immunoglobulin light chain (ie, a V/J segment) that encodes a human VL domain of an immunoglobulin light chain. In another aspect, the mouse comprises no more than two rearranged human VL gene segments that are capable of encoding a human VL domain of an immunoglobulin light chain.
[00016] In one embodiment, the VL gene segment is a human VK1-39JK5 gene segment or a human VK3-20JK1 gene segment. In one embodiment, the mouse has both a human VK1-39JK5 gene segment and a human VK3-20JK1 gene segment.
[00017] In one embodiment, the human VL gene segment is operably linked to a human or mouse leader sequence. In one modality, the leader sequence is a mouse leader sequence. In a specific embodiment, the mouse leader sequence is a mouse VK3-7 leader sequence.
[00018] In one embodiment, the VL gene segment is operably linked to an immunoglobulin promoter sequence. In one embodiment, the promoter sequence is a human promoter sequence. In a specific embodiment, the human immunoglobulin promoter is a VK3-15 promoter.
[00019] In one embodiment, the genetically modified mouse comprises a VL locus that does not comprise an endogenous mouse VL gene segment that is capable of rearrangement to form an immunoglobulin light chain gene, wherein the VL locus comprises a gene segment A unique human VL that is capable of rearrangement to encode a VL region of a light chain gene. In a specific embodiment, the human VL gene segment is a human VK1-39JK5 gene segment or a human VK3-20JK1 gene segment.
[00020] In one embodiment, the VL locus comprises a leader sequence 5' flanked (with respect to the transcriptional direction of the VL gene segment) with a human immunoglobulin promoter and 3' flanked with a human VL gene segment that rearranges and encodes the domain VL of a reverse chimeric light chain comprising an endogenous mouse light chain constant region (CL). In a specific modality, the VL gene segment is at the kappa (K) mouse VL locus, and mouse CL is a mouse K CL.
[00021] In one embodiment, the mouse comprises a non-functional lambda (À) immunoglobulin light chain locus. In a specific embodiment, the À locus comprises a deletion of one or more sequences from the locus, where one or more deletions provide the À locus incapable of rearrangement to form a light chain gene. In another embodiment all or substantially all VL gene segments of the À locus are deleted.
[00022] In one embodiment, the modified mouse VL locus is a k locus, and the k locus comprises a mouse K intronic enhancer, a mouse 3’ K enhancer, or both an intronic enhancer and a 3’ enhancer.
[00023] In one embodiment, the mouse produces a light chain that comprises a somatically mutated VL domain derived from a human VL gene segment. In one embodiment, the light chain comprises a somatically mutated VL domain derived from a human VL gene segment, and a mouse CL k region. In one embodiment, the mouse does not express an À light chain.
[00024] In one embodiment, the genetically modified mouse is able to somatically hypermutate the human VL region sequence. In a specific embodiment, the mouse comprises a cell comprising a rearranged immunoglobulin light chain gene derived from the human VL gene segment which is capable of rearrangement and encoding a VL domain, and the rearranged immunoglobulin light chain gene comprises a domain somatically mutated VL.
[00025] In one embodiment, the mouse comprises a cell that expresses a light chain comprising a somatically mutated human VL domain linked to a mouse k CL, wherein the light chain associates with a heavy chain comprising a somatically mutated VH domain derived from a human VH gene segment and where the heavy chain comprises a mouse heavy chain (CH) constant region.
[00026] In one embodiment, the mouse comprises a replacement of endogenous mouse VH gene segments with one or more human VH gene segments, wherein the human VH gene segments are operably linked to a mouse CH region gene, such as that the mouse rearranges the human VH gene segments and expresses a reverse chimeric immunoglobulin heavy chain that comprises a human VH domain and a mouse CH. In one embodiment, 90-100% of the unrearranged mouse VH gene segments are replaced by at least one unrearranged human VH gene segment. In a specific embodiment, all or substantially all endogenous mouse VH gene segments are replaced by at least one unrearranged human VH gene segment. In one embodiment, the replacement is with at least 19, at least 39, or at least 80 or 81 unrearranged human VH gene segments. In one embodiment, the replacement is with at least 12 functional unrearranged human VH gene segments, at least 25 functional unrearranged human VH gene segments, or at least 43 functional unrearranged human VH gene segments. In one embodiment, the mouse comprises a replacement of all mouse D and J segments with at least one unrearranged human D segment and at least one unrearranged human J segment. In one embodiment, at least one unrearranged human D segment is selected from D1-7, D1-26, D3-3, D3-10, D3-16, D3-22, D5-5, D5-12, D6 -6, D6-13, D7-27, and a combination thereof. In one embodiment, at least one unrearranged human J segment is selected from J1, J3, J4, J5, J6, and a combination thereof. In a specific embodiment, one or more human VH gene segment is selected from a 1-2, 1-8, 1-24, 2-5, 3-7, 3-9, 3-11, 3-13 , 3-15, 3-20, 3-23, 3-30, 3-33, 3-48, 4-31, 4-39, 4-59, 5-51, a human 6-1 VH gene segment, and a combination of them.
[00027] In one embodiment, the mouse comprises a B cell that expresses a binding protein that specifically binds to an antigen of interest, wherein the binding protein comprises a light chain derived from a human or human VK1-39/JK5 rearrangement. a human VK3-20/JK1 rearrangement, and wherein the cell comprises a rearranged immunoglobulin heavy chain gene derived from a rearrangement of human gene segments selected from a gene segment VH2-5, VH3-23, VH3-30, VH 4-39, VH4-59 and VH5-51. In one embodiment, one or more human VH gene segments are rearranged with a human heavy chain J gene segment selected from J1, J3, J4, J5 and J6. In one embodiment, one or more human VH and J gene segments are rearranged with a human D gene segment selected from D1-7, D1-26, D3-3, D3-10, D3-16, D3-22, D5 -5, D5-12, D6-6, D6-13 and D7-27. In a specific embodiment, the light chain gene has 1, 2, 3, 4 or 5 or more somatic hypermutations.
[00028] In one embodiment, the mouse comprises a B cell comprising a rearranged immunoglobulin heavy chain variable region gene sequence comprising a VH, JH and DH gene segment selected from VH 2-5 + JH1 + D6- 6, VH3-23 + JH4 + D3, VH3-23 + JH4 + D3-10, VH3-30 + JH1 + D6-6, VH3-30 +JH3 + D6-6, VH3-30 + JH4 + D1-7, VH3-30 + JH4 + D5-12, VH3-30 + JH4 + D6-13, VH3-30 + JH4 + D6-6, VH3-30 + JH4 +D7-27, VH3-30 + JH5 + D3-22, VH3-30 + JH5 + D6-6, VH3-30 + JH5 +D7-27, VH4-39 + JH3 + D1-26, VH4-59 + JH3 + D3-16, VH4-59 + JH3+ D3-22, VH4 -59 + JH4 + D3-16, VH5-51 + JH3 + D5-5, VH5-51 + JH5+ D6-13, and VH5-51 + JH6 + D3-16. In a specific embodiment, the B cell expresses a binding protein comprising a human immunoglobulin heavy chain variable region fused to a mouse heavy chain constant region, and a human immunoglobulin light chain variable region fused to a mouse constant region. mouse light chain.
[00029] In one embodiment, the human VL gene segment is a human VK1-39JK5 gene segment, and the mouse expresses a reverse chimeric light chain comprising (i) a VL domain derived from the human VL gene segment and (ii) a CL from mouse; wherein the light chain is associated with a reverse chimeric heavy chain comprising (i) a mouse CH and (ii) a somatically mutated human VH domain derived from a human VH gene segment selected from a human VH gene segment 1-2 , 1-8, 1-24, 2-5, 3-7, 3-9, 3-11, 3-13, 3-15, 3-20, 3-23, 3-30, 3-33, 3 -48, 4-31, 4-39, 4-59, 5-51 and 6-1, and a combination thereof. In one embodiment, the mouse expresses a light chain that is somatically mutated. In a CL modality it is a mouse K CL.
[00030] In one embodiment, the human VL gene segment is a human VK3-20JK1 gene segment, and the mouse expresses a reverse chimeric light chain comprising (i) a VL domain derived from the human VL gene segment, and (ii) a CL of mouse; wherein the light chain is associated with a reverse chimeric heavy chain comprising (i) a mouse CH, and (ii) a somatically mutated human VH derived from a human VH gene segment selected from a human VH gene segment 1-2 , 2-5, 3-7, 3-9, 3-11, 3-20, 3-23, 3-30, 3-33, 4-59 and 5-51, and a combination thereof. In one embodiment, the mouse expresses a light chain that is somatically mutated. In one embodiment, the CL is a mouse K CL.
[00031] In one embodiment, the mouse comprises both a human VK1-39JK5 gene segment and a human VK3-20JK1 gene segment, and the mouse expresses a reverse chimeric light chain comprising (i) a VL domain derived from a VK1- gene segment. human 39JK5 or a human VK3-20JK1 gene segment, and (ii) a mouse CL; wherein the light chain is associated with a reverse chimeric heavy chain comprising (i) a mouse CH, and (ii) a somatically mutated human VH derived from a human VH gene segment selected from a human VH gene segment 1-2 , 1-8, 1-24, 2-5, 3-7, 3-9, 3-11, 3-13, 3-15, 3-20, 3-23, 3-30, 3-33, 3 -48, 4-31, 4-39, 4-59, 5-51, 61, and a combination thereof. In one embodiment, the mouse expresses a light chain that is somatically mutated. In one embodiment, the CL is a mouse K CL.
[00032] In one embodiment, 90 to 100% of the endogenous unrearranged mouse VH gene segments are replaced by at least one unrearranged human VH gene segment. In a specific embodiment, all or substantially all endogenous unrearranged mouse VH gene segments are replaced by at least one unrearranged human VH gene segment. In one embodiment, the replacement is with at least 18, at least 39, at least 80, or 81 unrearranged human VH gene segments. In one embodiment, the replacement is with at least 12 functional unrearranged human VH gene segments, at least 25 functional unrearranged human VH gene segments, or at least 43 unrearranged human VH gene segments.
[00033] In one modality, the genetically modified mouse is a C57BL strain, in a specific modality selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/ 6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, C57BL/Ola. In a specific modality, the genetically modified mouse is a mixture of a aforementioned 129 strain and a aforementioned C57BL/6 strain. In another specific embodiment, the mouse is a mixture of 129 strains mentioned above, or mixture of BL/6 strains mentioned above. In a specific modality, the 129 strain of the mixture is a 129S6 strain (129/SvEvTac).
[00034] In one embodiment, the mouse expresses a reverse chimeric antibody comprising a light chain comprising a mouse K CL domain and a somatically mutated human VL derived from a human VK1-39JK5 gene segment or a human Vk3-20Jk1 gene segment, and a heavy chain comprising a mouse CH domain and a somatically mutated human VH derived from a human VH gene segment selected from a human VH gene segment 1-2, 1-8, 1-24, 2-5, 3 -7, 3-9, 3-11, 3-13, 3-15, 3-20, 3-23, 3-30, 3-33, 3-48, 4-31, 4-39, 4-59 , 5-51, and 6-1, in which the mouse does not express a fully mouse antibody and does not express a fully human antibody. In one embodiment, the mouse comprises a k light chain locus that comprises a replacement of endogenous mouse k VL gene segments with either the human Vk1-39Jk5 gene segment or the human Vk3-20Jk1 gene segment, and comprises a substitution of all or substantially all endogenous mouse VH gene segments with a complete or substantially complete repertoire of human VH gene segments.
[00035] In one aspect, a mouse cell is provided that is isolated from a mouse as described in this application. In one embodiment, the cell is an ES cell. In one embodiment, the cell is a lymphocyte. In one embodiment, the lymphocyte is a B cell. In one embodiment, the B cell expresses a chimeric heavy chain that comprises a variable domain derived from a human gene segment; and a light chain derived from a human rearranged segment Vk1-39/J, human rearranged segment Vk3-20/J, or a combination thereof; wherein the heavy chain variable domain is fused to a mouse constant region and the light chain variable domain is fused to a mouse or human constant region.
[00036] In one aspect, a hybridoma is provided, wherein the hybridoma is produced with a mouse B cell as described in this application. In a specific embodiment, the B cell is from a mouse, as described in this application, that has been immunized with an immunogen that comprises an epitope of interest, and the B cell expresses a binding protein that binds to the epitope of interest, the protein linker has a somatically mutated human VH domain and a mouse CH, and has a human VL domain derived from a human VK1-39JK5 or a human VK3-20JK1 gene segment and a mouse CL.
[00037] In one aspect, a mouse embryo is provided, wherein the embryo comprises an ES donor cell that is derived from a mouse as described in this application.
[00038] In one aspect, a targeting vector is provided, comprising, from 5' to 3' in the transcriptional direction with reference to the sequences of the 5' and 3' mouse homology arms of the vector, a 5' homology arm of the vector. mouse, a human or mouse immunoglobulin promoter, a human or mouse leader sequence, and a human LCVR gene segment selected from a human VK1-39JK5 gene segment or a human VK3-20JK1 gene segment, and a 3' homology arm of mouse. In one embodiment, the 5' and 3' homology arms direct the vector to a 5' sequence with respect to an enhancer sequence that is 5' present and proximal to the mouse K constant region gene. In one embodiment, the promoter is a human immunoglobulin variable region gene segment promoter. In a specific embodiment, the promoter is a human VK3-15 promoter. In one modality, the leader sequence is a mouse leader sequence. In a specific embodiment, the mouse leader sequence is a mouse VK3-7 leader sequence.
[00039] In one aspect, a targeting vector is provided as described above, but in place of the mouse 5' homology arm, the human or mouse promoter is 5' flanked with a site-specific recombinase recognition site ( SRRS), and in place of the mouse 3' homology arm, the human LCVR gene segment is flanked 3' with a SRRS.
[00040] In one aspect, a reverse chimeric antibody produced by a mouse as described in this application, wherein the reverse chimeric antibody comprises a light chain comprising a mouse CL and a human VL, and a heavy chain comprising a human VH and a Mouse CH.
[00041] In one aspect, a method for producing an antibody is provided, comprising expressing in a single cell (a) a first VH gene sequence from an immunized mouse as described in this application fused to a human CH gene sequence; (b) a VL gene sequence from an immunized mouse as described in this application fused to a human CL gene sequence; and, (c) maintaining the cell under conditions sufficient to express a fully human antibody, and isolating the antibody. In one embodiment, the cell comprises a second VH gene sequence from a second mouse immunized as described in this application fused to a human CH gene sequence, the first VH gene sequence encodes a VH domain that recognizes a first epitope, and the second gene sequence VH encodes a VH domain that recognizes a second epitope, where the first epitope and the second epitope are not identical.
[00042] In one aspect, a method for producing an epitope-binding protein is provided, comprising exposing a mouse as described in this application with an immunogen comprising an epitope of interest, keeping the mouse under conditions sufficient for the mouse to generating an immunoglobulin molecule that specifically binds to the epitope of interest, and isolating the immunoglobulin molecule that specifically binds to the epitope of interest; wherein the epitope binding protein comprises a heavy chain comprising a somatically mutated human VH and a mouse CH, associated with a light chain comprising a mouse CL and a human VL derived from a human VK1-39 JK5 gene segment or a human VK3-20 JK1.
[00043] In one aspect, a cell expressing an epitope binding protein is provided, wherein the cell comprises: (a) a human VL nucleotide sequence encoding a human VL domain derived from a human VK1-39JK5 gene segment or a human VK3-20JK1, wherein the human VL nucleotide sequence is fused (directly or by a linker) to a human immunoglobulin light chain constant domain cDNA sequence (e.g., a human K constant domain DNA sequence) ; and, (b) a first human VH nucleotide sequence encoding a human VH domain derived from a first human VH nucleotide sequence, wherein the first human VH nucleotide sequence is fused (directly or by a linker) to a domain cDNA sequence human immunoglobulin heavy chain constant; wherein the epitope binding protein recognizes a first epitope. In one embodiment, the epitope-binding protein binds to the first epitope with a dissociation constant lower than 10-6 M, lower than 10-8 M, lower than 10-9 M, lower than 10- 10M, lower than 10-11M, or lower than 10-12M.
[00044] In one embodiment, the cell comprises a second human VH nucleotide sequence encoding a second human VH domain, wherein the second human VH sequence is fused (directly or by a linker) to a constant chain domain cDNA sequence human immunoglobulin heavy, and in which the second human VH domain does not specifically recognize the first epitope (e.g., exhibits a dissociation constant, e.g., of 10-6 M, 10-5 M, 10-4 M, or more high), and wherein the epitope-binding protein recognizes the first epitope and the second epitope, and wherein the first and second immunoglobulin heavy chains each associate with an identical light chain as in (a).
[00045] In one embodiment, the second VH domain binds to the second epitope with a dissociation constant that is lower than 10-6 M, lower than 10-7 M, lower than 10-8 M, lower than 10-9 M, lower than 10-10 M, lower than 10-11 M, or lower than 10-12 M.
[00046] In one embodiment, the epitope-binding protein comprises a first immunoglobulin heavy chain and a second immunoglobulin heavy chain, each associated with an identical light chain derived from a human VL gene segment selected from a gene segment Human VK1-39JK5 or a human VK3-20JK1, wherein the first immunoglobulin heavy chain binds to a first epitope with a dissociation constant in the nanomolar to picomolar range, the second immunoglobulin heavy chain binds to a second epitope with a dissociation constant in the nanomolar to picomolar range, the first epitope and second epitope are not identical, the first immunoglobulin heavy chain does not bind to the second epitope, or binds to the second epitope with a weaker dissociation constant than whereas the micromolar band (eg, millimolar band), the second immunoglobulin heavy chain does not bind to the first epitope or binds to the first epitope with m a dissociation constant weaker than the micromolar band (eg, millimolar band), and one or more of VL, first immunoglobulin heavy chain VH, and second immunoglobulin heavy chain VH are somatically mutated.
[00047] In one embodiment, the first immunoglobulin heavy chain comprises a protein A binding residue, and the second immunoglobulin heavy chain lacking the protein A binding residue.
[00048] In one embodiment, the cell is selected from a CHO, COS, 293, HeLa, and retinal cell that expresses a viral nucleic acid sequence (eg, a PERC.6™ cell).
[00049] In one aspect, a reverse chimeric antibody is provided, comprising a human and mouse VH heavy chain constant domain, a human and mouse VL light chain constant domain, wherein the antibody is produced by a process comprising immunizing a mouse as described in this application with an immunogen comprising an epitope, and the antibody specifically binds to the epitope of the immunogen with which the mouse was immunized. In one embodiment, the VL domain is somatically mutated. In one embodiment, the VH domain is somatically mutated. In one modality, both the VL domain and the VH domain are somatically mutated. In one embodiment, the VL is linked to a mouse constant K domain.
[00050] In one aspect, a mouse is provided, comprising human heavy chain variable gene segments that replace all or substantially all mouse heavy chain variable gene segments at the endogenous mouse locus; no more than one or two human light chain variable gene segments selected from a rearranged VK1-39/J and a rearranged VK3-20/J or a combination thereof, replacing all of the human light chain variable gene segments. mouse; wherein the human heavy chain variable gene segments are linked to a mouse constant gene, and the human light chain variable gene segment(s) is linked to a mouse or human constant gene.
[00051] In one aspect, a mouse ES cell comprising a replacement of all or substantially all mouse heavy chain variable gene segments with human heavy chain variable gene segments, and no more than one or two V/J segments of rearranged human light chain, in which the human heavy chain variable gene segments are linked to a mouse immunoglobulin heavy chain constant gene, and the human light chain V/J segments are linked to a mouse light chain constant gene. mouse or human immunoglobulin. In a specific embodiment, the constant light chain gene is a constant mouse gene.
[00052] In one aspect, an antigen-binding protein made by a mouse as described in this application is provided. In a specific embodiment, the antigen binding protein comprises a human immunoglobulin heavy chain variable region fused to a mouse constant region, and a human immunoglobulin light chain variable region derived from a VK1-39 gene segment or a segment gene VK3-20, in which the constant region of the light chain is a mouse constant region.
[00053] In one aspect, a fully human antigen binding protein made from a mouse immunoglobulin variable region gene sequence as described in this application is provided, wherein the antigen binding protein comprises a fully human heavy chain which comprises a human variable region derived from a mouse sequence as described in this application, and a fully human light chain which comprises a VK1-39 or a VK3-20 variable region. In one embodiment, the light chain variable region comprises one to five somatic mutations. In one embodiment, the light chain variable region is a cognate light chain variable region that is paired in a mouse B cell with the heavy chain variable region.
[00054] In one embodiment, the fully human antigen-binding protein comprises a first heavy chain and a second heavy chain, wherein the first heavy chain and second heavy chain comprise non-identical variable regions independently derived from a mouse as described herein. application, and wherein each of the first and second heavy chains express from a host cell associated with a human light chain derived from a VK1-39 gene segment or a VK3-20 gene segment. In one embodiment, the first heavy chain comprises a first heavy chain variable region that specifically binds to a first epitope of a first antigen, and the second heavy chain comprises a second heavy chain variable region that specifically binds to a second epitope of a second antigen. In a specific modality, the first antigen and the second antigen are different. In a specific embodiment, the first antigen and the second antigen are the same, and the first epitope and the second epitope are not identical; in a specific embodiment, binding of the first epitope by a first binding protein molecule does not block binding of the second epitope by a second binding protein molecule.
[00055] In one aspect, a fully human binding protein derived from a mouse human immunoglobulin sequence as described in this application comprises a first immunoglobulin heavy chain and a second immunoglobulin heavy chain, wherein the first immunoglobulin heavy chain comprises a first variable region which is not identical to a variable region of the second immunoglobulin heavy chain, and wherein the first immunoglobulin heavy chain comprises a wild type protein A binding determinant, and the second heavy chain without a binding determinant to wild protein A. In one embodiment, the first immunoglobulin heavy chain binds to protein A under isolation conditions, and the second immunoglobulin heavy chain does not bind to protein A or binds to protein A at least 10 times, a hundred times, or a thousand times weaker than the first immunoglobulin heavy chain binds to protein A under isolation conditions. In a specific embodiment, the first and second heavy chains are IgG1 isotypes, wherein the second heavy chain comprises a modification selected from 95R (EU 435R), 96F (EU 436F), and a combination thereof, and where the first heavy chain does not need such modification.
[00056] In one aspect, a method for producing a bispecific antigen-binding protein is provided, comprising exposing a first mouse as described in this application to a first antigen of interest comprising a first epitope, exposing a second mouse as described in this application to a second antigen of interest that comprises a second epitope, allowing the first and second mice each to mount immune responses to the antigens of interest, identification in the first mouse of a first human heavy chain variable region that binds to the first epitope of the first antigen of interest, identification in the second mouse of a second human heavy chain variable region that binds to the second epitope of the second antigen of interest, production of a first fully human heavy chain gene that encodes a first heavy chain that binds to the first epitope of the first antigen of interest, producing an s second fully human heavy chain gene encoding a second heavy chain that binds to the second epitope of the second antigen of interest, expressing the first heavy chain and second heavy chain in a cell expressing a single fully human light chain derived from one segment gene VK1-39 or a human VK3-20 to form a bispecific antigen-binding protein, and isolation of the bispecific antigen-binding protein.
[00057] In one embodiment, the first antigen and the second antigen are not identical.
[00058] In one embodiment, the first antigen and second antigen are identical, and the first epitope and second epitope are not identical. In one embodiment, binding of the first heavy chain variable region to the first epitope does not block the binding of the second heavy chain variable region to the second epitope.
[00059] In one embodiment, the first antigen is selected from a soluble antigen and a cell surface antigen (eg, a tumor antigen), and the second antigen comprises a cell surface receptor. In a specific embodiment, the cell surface receptor is an immunoglobulin receptor. In a specific embodiment, the immunoglobulin receptor is an Fc receptor. In one embodiment, the first antigen and the second antigen are the same cell surface receptor, and the binding of the first heavy chain to the first epitope does not block the binding of the second heavy chain to the second epitope.
[00060] In one embodiment, the light chain variable domain of the light chain comprises 2 to 5 somatic mutations. In one embodiment, the light chain variable domain is a somatically mutated cognate light chain expressed in a B cell of the first or second mouse immunized with the first or second heavy chain variable domain.
[00061] In one embodiment, the first fully human heavy chain carries an amino acid modification that reduces its affinity for protein A, and the second fully human heavy chain does not comprise a modification that reduces its affinity for protein A.
[00062] In one aspect, an antibody or a bispecific antibody comprising a human heavy chain variable domain produced in accordance with the invention is provided. In another aspect, the use of a mouse as described in this application for producing a fully human antibody or a fully human bispecific antibody is provided.
[00063] Any of the modalities and aspects described in this application may be used in conjunction with another, unless otherwise indicated or evident from the context. Other embodiments will become apparent to those skilled in the art from a review of the following description. DETAILED DESCRIPTION
[00064] This invention is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used in this application is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present invention is defined by the claims.
[00065] Unless otherwise defined, all terms and phrases used in this application include the meanings that the terms and phrases have achieved in the art, unless the contrary is clearly indicated or clearly evident from the context in which the term or the phrase are used. While any method and materials similar or equivalent to those described in this application can be used in practicing or testing the present invention, particular methods and materials are now described. All publications mentioned are hereby incorporated by reference.
[00066] The term "antibody", as used in this application, includes immunoglobulin molecules comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region comprises three domains, CH1, CH2 and CH3. Each light chain comprises a light chain variable region (VL) and a light chain constant region (CL). The VH and VL regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDR), interspersed with regions that are more conserved, called conserved regions (FR). Each VH and VL comprises three CDRs and four FRs, arranged from amino-terminal to carboxy-terminal in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs can be abbreviated as HCDR1, HCDR2 and HCDR3; the light chain CDRs can be abbreviated as LCDR1, LCDR2 and LCDR3). The term "high affinity" antibody refers to an antibody that has a KD with respect to its target epitope of approximately 10-9 M or lower (eg approximately 1 x 10-9 M, 1 x 10-10 M, 1 x 10-11 M or approximately 1 x 10-12 M). In one embodiment, KD is measured by surface plasmon resonance, eg, BIACORE™; in another embodiment, KD is measured by ELISA.
[00067] The phrase "bispecific antibody" includes an antibody capable of selectively binding to two or more epitopes. Bispecific antibodies generally comprise two non-identical heavy chains, with each heavy chain specifically binding to a different epitope - one on two different molecules (eg, different epitopes on two different immunogens) or on the same molecule (eg, different epitopes on even immunogen). If a bispecific antibody is capable of selectively binding to two different epitopes (a first epitope and a second epitope), the affinity of the first heavy chain of the first epitope will generally be at least one to two or three or four or more orders of magnitude lower than the affinity of the first heavy chain of the second epitope, and vice versa. The epitopes specifically bound to the bispecific antibody can be on the same or a different target (e.g., on the same or a different protein). Bispecific antibodies can be produced, for example, by combining heavy chains that recognize different epitopes from the same immunogen. For example, nucleic acid sequences encoding heavy chain variable sequences that recognize different epitopes of the same immunogen can be fused to nucleic acid sequences that encode the same heavy chain or different constant regions, and such sequences can be expressed in a cell which expresses an immunoglobulin light chain. A typical bispecific antibody has two heavy chains each having three heavy chain CDRs, followed (N-terminal to C-terminal) by a CH1 domain, a hinge, a CH2 domain, and a CH3 domain, and an immunoglobulin light chain which does not confer epitope binding specificity but which may associate with each heavy chain, or which may associate with each heavy chain and which may bind one or more epitopes linked by the heavy chain epitope binding regions, or that it can associate with each heavy chain and capable of binding one or both heavy chains to one or both epitopes.
[00068] The term "cell" includes any cell that is suitable for expression of a recombinant nucleic acid sequence. Cells include those from prokaryotes and eukaryotes (single cell or multiple cell), bacterial cells (eg, E. coli strains, Bacillus spp., Streptomyces spp., etc.), mycobacterial cells, fungal cells, yeast cells (eg, S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (eg, SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.). Non-human animal cells, human cells, or cell fusions such as, for example, hybridomas or quadromas. In some embodiments, a cell is a human, ape, great ape, hamster, rat, or mouse cell. In some embodiments, the cell is eukaryotic and is selected from the following cells: CHO (eg CHO K1, DXB-11 CHO, Veggie-CHO), COS (eg COS 7), retinal cell, Vero, CV1 , renal (eg HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (eg BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cell, C127 cell, SP2/0, NS-0, MMT 060562, Sertoli cell, BRL 3A cell, HT1080 cell, myeloma cell, tumor cell, and one cell line derived from a cell mentioned above. In some embodiments, the cell comprises one or more viral genes, e.g., a retinal cell that expresses a viral gene (e.g., a PER.C6™ cell).
[00069] The phrase "complementarity determining region" or term "CDR" includes an amino acid sequence encoded by a nucleic acid sequence of immunoglobulin genes from an organism that normally (i.e., in a wild animal) appears between two conserved regions in a variable region of a light or heavy chain of an immunoglobulin molecule (for example, an antibody or a T cell receptor). A CDR can be encoded, for example, by a germline sequence or a rearranged or unrearranged sequence, and, for example, by a naive or a mature B cell or a T cell. A CDR can be somatically mutated (for example, , range from an encoded sequence in the germline of an animal), humanized, and/or modified with amino acid substitutions, additions, or deletions. In some circumstances (eg, for a CDR3), CDRs may be encoded by two or more sequences (eg, germline sequences) that are not contiguous (eg, in an unrearranged nucleic acid sequence) but are contiguous sequences in a B-cell nucleic acid sequence, for example, as the result of splicing or splicing the sequences (eg, VDJ recombination to form a CDR3 heavy chain).
[00070] The term "conservative", when used to describe a conservative amino acid substitution, includes the replacement of an amino acid residue with another amino acid residue that has a side chain R group with similar chemical properties (eg charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially modify the functional properties of interest of a protein, for example, the ability of a variable region to specifically bind a target epitope with a desired affinity. Examples of groups of amino acids that have side chains with similar chemical properties include aliphatic side chains such as glycine, alanine, valine, leucine and isoleucine; aliphatic and hydroxyl side chains such as serine and threonine; amide-containing side chains such as asparagine and glutamine; aromatic side chains such as phenylalanine, tyrosine and tryptophan; basic side chains such as lysine, arginine, and histidine; acidic side chains such as aspartic acid and glutamic acid; and, sulfur-containing side chains such as cysteine and methionine. Conservative amino acid substitution groups include, for example, valine/leucine/isoleucine, phenylalanine/tyrosine, lysine/arginine, alanine/valine, glutamate/aspartate and asparagine/glutamine. In some embodiments, a conservative amino acid substitution can be replacement of any native residue in a protein with alanine, as used, for example, in scanning alanine mutagenesis. In some embodiments, a conservative substitution is made for the one that has a positive value in the PAM250 log probability matrix described in Gonnet et al. (1992) Exhaustive Matching of the Entire Protein Sequence Database, Science 256:1443-45, hereby incorporated by reference. In some embodiments, the substitution is a moderately conservative substitution where the substitution has a non-negative value in the PAM250 log probability matrix.
[00071] In some embodiments, residue positions in an immunoglobulin light chain or heavy chain are differentiated by one or more conservative amino acid substitutions. In some embodiments, residue positions in an immunoglobulin light chain or functional fragment thereof (eg, a fragment that allows expression and secretion, for example, from a B cell) are not identical to a light chain whose amino acid sequence is listed in this application, but is distinguished by one or more conservative amino acid substitutions.
[00072] The phrase "epitope binding protein" includes a protein having at least one CDR and is able to selectively recognize that an epitope, for example, is capable of binding an epitope with a KD that is in approximately one micromolar or lower (eg a KD that is approximately 1 x 10-6 M, 1 x 10-7 M, 1 x 10-9 M, 1 x 10-9 M, 1 x 10-10 M, 1 x 10-11 M, or approximately 1 x 10-12 M). Therapeutic epitope-binding proteins (eg, therapeutic antibodies) often require a KD that is in the nanomolar or picomolar range.
[00073] The phrase "functional fragment" includes epitope-binding protein fragments that can be expressed, secreted, and specifically bind to an epitope with a KD in the micromolar, nanomolar, or picomolar range. Specific recognition includes having a KD that is at least in the micromolar range, nanomolar range, or picomolar range.
[00074] The term "germ lineage" includes reference to an immunoglobulin nucleic acid sequence in a non-somatically mutated cell, for example, a non-somatically mutated B cell or pre-B cell or hematopoietic cell.
[00075] The phrase "heavy chain" or "immunoglobulin heavy chain" includes an immunoglobulin heavy chain constant region sequence of any organism. Heavy chain variable domains include three heavy chain CDRs and four FR regions, unless otherwise specified. Heavy chain fragments include CDRs, CDRs and FRs, and combinations thereof. A typical heavy chain has, after the variable domain (N-terminal to C-terminal), a CH1 domain, a hinge, a CH2 domain, and a CH3 domain. A functional fragment of a heavy chain includes a fragment that is capable of specifically recognizing an epitope (eg, recognizing the epitope with a KD in the micromolar, nanomolar, or picomolar range), that is capable of expression and secretion from a cell, and that comprises at least one CDR.
[00076] The term "identity" when used in relation to sequence, includes identity as determined by several different algorithms known in the art that can be used to measure nucleotide and/or amino acid sequence identity. In some embodiments described in this application, identity is determined using a ClustalW v alignment. 1.83 (slow) which employs an open gap penalty of 10.0, an extension gap penalty of 0.1, and uses a Gonnet similarity matrix (MacVector™ 10.0.2, MacVector Inc, 2008). The length of the sequences compared with respect to sequence identity will depend on the particular sequences, but in case of a constant domain of the light chain, the length must contain the sequence of sufficient length to fold into a constant domain of the light chain that is capable of self-association. to form a canonical constant domain of the light chain, for example, capable of forming two beta sheets comprising beta strands and capable of interacting with at least one CH1 domain of a human or mouse. In case of a CH1 domain, the length of the sequence must contain the sequence of sufficient length to fold into a CH1 domain that is capable of forming two beta sheets comprising beta strands and capable of interacting with at least one constant domain of the light chain. of a mouse or a human being.
[00077] The phrase "immunoglobulin molecule" includes two immunoglobulin heavy chains and two immunoglobulin light chains. Heavy chains can be identical or different, and light chains can be identical or different.
[00078] The phrase "light chain" includes an immunoglobulin light chain sequence from any organism, and unless otherwise specified includes human K and A light chains and a VpreB as well as surrogate light chains. Light chain variable domains (VL) typically include three light chain CDRs and four conserved regions (FR), unless otherwise specified. Generally, an entire light chain includes, from the amino terminus to the carboxy terminus, a VL domain that includes FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a light chain constant domain. Light chains include those, for example, that do not selectively bind to a first or second epitope selectively bound by the epitope-binding protein in which they appear. Light chains also include those that bind and recognize, or assist the heavy chain with binding and recognition, of one or more epitopes selectively bound by the epitope-binding protein in which they appear. Common light chains are those derived from a human Vk1-39Jk5 gene segment or a human Vk3-20Jk1 gene segment, and include somatically mutated (eg, affinity-matured) versions thereof.
[00079] The phrase "micromolar range" is intended to mean 1-999 micromolar; the phrase "nanomolar range" is intended to mean 1-999 nanomolar; the phrase "picomolar range" is intended to mean 1-999 picomolar.
The phrase "somatically mutated" includes reference to a nucleic acid sequence of a class-switched B cell, wherein the nucleic acid sequence of an immunoglobulin variable region (e.g., a heavy chain variable domain or including a heavy chain CDR or FR sequence) in the class switched B cell is not identical to the nucleic acid sequence in the B cell before the class switch, such as, for example, a difference in a CDR or acid sequence region nucleic acids conserved between a non-class-switched B cell and a class-switched B cell. "Somatically mutated" includes reference to affinity matured B cell nucleic acid sequences that are not identical to variable region sequences of corresponding immunoglobulins in B cells that are not affinity matured (ie, sequences in the genome of germline cells). The phrase "somatically mutated" also includes reference to an immunoglobulin variable region nucleic acid sequence of a B cell after exposure of the B cell to an epitope of interest, wherein the nucleic acid sequence differs from the corresponding nucleic acid sequence before B cell exposure to the epitope of interest. The phrase "somatically mutated" refers to antibody sequences that were generated in an animal, for example, a mouse having human immunoglobulin variable region nucleic acid sequences, in response to an immunogen challenge, and that result from inherently operational selection processes in such an animal.
The term "unrearranged", with reference to a nucleic acid sequence, includes nucleic acid sequences that exist in the germline of an animal cell.
[00082] The phrase "variable domain" includes an amino acid sequence of an immunoglobulin light or heavy chain (modified as desired) which comprises the following amino acid regions, in sequence from N-terminal to C-terminal (unless otherwise noted). otherwise indicated): FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Common Light Chain
[00083] Previous efforts to produce useful multispecific epitope binding proteins, eg bispecific antibodies, have been hampered by a variety of problems that often share a common paradigm: in vitro selection or sequence manipulation to rationally engender, or to engender by trial and error, a suitable format for pairing a human immunoglobulin bispecific heterodimer. Unfortunately, most if not all in vitro engineering approaches basically provide ad hoc corrections that are suitable, if at all, for individual molecules. On the other hand, in vivo methods to employ complex organisms to select appropriate pairings that are capable of leading to human therapeutic products have not been performed.
[00084] Generally, native mouse sequences are often not a good source for human therapeutic sequences. For at least this reason, generation of mouse heavy chain immunoglobulin variable regions that pair with a common human light chain is of limited practical utility. Further in vitro engineering efforts would be expended in a trial and error process to try to humanize mouse heavy chain variable sequences hoping to conserve epitope specificity and affinity while retaining the ability to bind to the common human light chain, with the outcome uncertain. At the end of such a process, the final product might retain some specificity and affinity, and associate with the common light chain, but ultimately, immunogenicity in a human would likely remain a profound risk.
Therefore, a mouse suitable for production of human therapeutics would include an appropriately large repertoire of human heavy chain variable region gene segments in place of the endogenous mouse heavy chain variable region gene segments. Human heavy chain variable region gene segments must be able to rearrange and recombine with an endogenous mouse heavy chain constant domain to form a reverse chimeric heavy chain (i.e., a heavy chain comprising a human variable domain and a constant region of mouse). The heavy chain must be capable of class switching and somatic hypermutation so that an appropriately large repertoire of heavy chain variable domains is available for the mouse to select one that can associate with the limited repertoire of human light chain variable regions.
[00086] A mouse that selects a common light chain from a plurality of heavy chains has a practical utility. In various embodiments, antibodies that express in a mouse that can only express a common light chain will have heavy chains that can associate and express with an identical or substantially identical light chain. This is particularly useful in creating bispecific antibodies. For example, such a mouse can be immunized with a first immunogen to generate a B cell that expresses an antibody that specifically binds to a first epitope. The mouse (or a genetically identical mouse) can be immunized with a second immunogen to generate a B cell that expresses an antibody that specifically binds to the second epitope. The variable heavy regions can be cloned from B cells and expressed with the same heavy chain constant region, and the same light chain, and expressed in a cell to produce a bispecific antibody, in which the light chain component of the bispecific antibody has been selected by a mouse to associate and express with the light chain component.
[00087] The inventors have engineered a mouse to generate immunoglobulin light chains that will aptly join a quite diverse family of heavy chains, including heavy chains whose variable regions depart from germline sequences, eg affinity-matured or somatically variable regions mutated. In various embodiments, the mouse is invented to pair human light chain variable domains with human heavy chain variable domains that comprise somatic mutations, thereby allowing a pathway to high-affinity binding proteins suitable for use as human therapeutics.
[00088] The genetically engineered mouse, through the long and complex process of antibody selection within an organism, makes biologically appropriate choices in pairing a diverse collection of human heavy chain variable domains with a limited number of human light chain options . In order to achieve this, the mouse is engineered to present a limited number of human light chain variable domain options along with a wide diversity of human heavy chain variable domain options. In the challenge with an immunogen, the mouse maximizes the number of solutions in its repertoire to develop an antibody to the immunogen, limited largely or only by the number or light chain options in its repertoire. In various embodiments, which include allowing the mouse to achieve suitable and compatible somatic mutations of the light chain variable domain which will nevertheless be compatible with a relatively large variety of human heavy chain variable domains, including in particular somatically mutated human heavy chain variable domains.
[00089] To achieve a limited repertoire of light chain options, the mouse is engineered to render non-functional or substantially non-functional its ability to make, or rearrange, a native mouse light chain variable domain. This can be achieved, for example, by deleting the variable region gene segments from the mouse light chain. The endogenous mouse locus can then be modified by an appropriate exogenous human light chain variable region gene segment of choice, operably linked to the endogenous mouse light chain constant domain, in such a way that the exogenous human variable region gene segments can rearrange and recombine with the light chain of the endogenous mouse constant region gene and form a rearranged reverse chimeric light chain gene (human variable, mouse constant). In various embodiments, the light chain variable region is capable of being somatically mutated. In various embodiments, to maximize the ability of the light chain variable region to acquire somatic mutations, the appropriate enhancer(s) is conserved in the mouse. For example, in modifying a mouse K locus to replace the endogenous variable region mouse K gene segments with human k variable region gene segments, the mouse intronic k enhancer and 3' mouse k enhancer are functionally maintained, or not interrupted.
[00090] A genetically engineered mouse is provided that expresses a limited repertoire of chimeric reverse light chains (human variable, mouse constant) associated with a diversity of chimeric reverse heavy chains (human variable, mouse constant). In various modalities, endogenous mouse K light chain variable region gene segments are deleted and replaced by single (or two) human light chain variable region gene segments operably linked to the endogenous mouse constant region gene. In modalities to maximize somatic hypermutation of the human light chain variable region gene segments, the mouse intronic k enhancer and the 3’ mouse k enhancer are maintained. In various embodiments, the mouse also comprises a non-functional light chain locus, or deletion thereof, or a deletion that renders the locus incapable of producing an light chain.
[00091] A genetically engineered mouse is provided that, in various embodiments, comprises a light chain variable region locus that lacks an endogenous mouse light chain variable gene segment and comprises a human variable gene segment, in one embodiment, a rearranged human V/J sequence, operatively linked to a mouse constant region, where the locus is capable of somatic hypermutation, and where the locus expresses a light chain comprising the human V/J sequence linked to a mouse constant region . Thus, in several modalities, the locus comprises a mouse 3’ k potentiator, which is correlated with a level of normal or wild-type somatic hypermutation.
[00092] The mouse genetically engendered in various modalities when immunized with an antigen of interest generates B cells that exhibit a diversity of rearrangements of human immunoglobulin heavy chain variable regions that express and function with one or two rearranged light chains, including modalities where one or two light chains comprise human light chain variable regions that comprise, for example, 1 to 5 somatic mutations. In various embodiments, the human light chains thus expressed are capable of association and expression with any human heavy chain variable region immunoglobulin expressed in the mouse.Epitope-Binding Proteins That Bind More Than One Epitope
[00093] The compositions and methods of those described in this application can be used to produce binding proteins that bind to more than one epitope with high affinity, for example, bispecific antibodies. Advantages of the invention include the ability to select appropriately high heavy chain binding (e.g., affinity matured) from immunoglobulin chains each of which will associate with a single light chain.
[00094] The synthesis and expression of bispecific binding proteins have been problematic, in part due to issues associated with identifying a suitable light chain that can associate and express with two different heavy chains, and in part due to isolation issues . The methods and compositions described in this application allow a genetically modified mouse to select, by otherwise natural processes, a suitable light chain that can associate and express with more than one heavy chain, including heavy chains that are somatically mutated (eg, matured by affinity). Suitable human B cell VL and VH sequences from mice immunized as described in this application express affinity-matured antibodies having reverse chimeric heavy chains (i.e., human variables and mouse constants) can be identified and cloned in frame into an expression vector with an appropriate human constant region gene sequence (eg, a human IgG1). Such two constructs can be prepared, where each construct encodes a human heavy chain variable domain that binds to a different epitope. One of the human VLs (e.g. human VK1-39JK5 or human VK3-20JK1) in the germline or B cell sequence in which the sequence has been somatically mutated can be fused in frame to a suitable human constant region gene (eg a human constant K gene). These three fully human heavy and light constructs can be placed in a suitable expression cell. The cell will express two main species: a homodimeric heavy chain with the identical light chain, and a heterodimeric heavy chain with the identical light chain. To allow easy separation of these major species, one of the heavy chains is modified to omit a protein A binding determinant, resulting in a differential affinity of a homodimeric binding protein from a heterodimeric binding protein. Compositions and methods addressing this issue are described in USSN 12/832,838, filed June 25, 2010, entitled "Readily Isolated Bispecific Antibodies with Native Immunoglobulin Format" published as US 2010/0331527A1, hereby incorporated by reference.
[00095] In one aspect, an epitope binding protein as described in this application is provided, wherein human VL and VH sequences are derived from mice described in this application that have been immunized with an antigen comprising an epitope of interest.
[00096] In one embodiment, an epitope-binding protein is provided comprising a first and a second polypeptide, the first comprising polypeptide, from the N-terminus to the C-terminus, of a first epitope-binding region that selectively binds to a first epitope, followed by a constant region comprising a first CH3 region of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and, a second comprising polypeptide, from the N-terminus to the C-terminus, a second epitope binding region that selectively binds to a second epitope, followed by a constant region comprising a second CH3 region of a human IgG selected to from IgG1, IgG2, IgG4, and a combination thereof, wherein the second CH3 region comprises a modification that reduces or eliminates binding of the second CH3 domain to protein A.
[00097] In one embodiment, the second CH3 region comprises a modification of H95R (by IMGT exon numbering; H435R by EU numbering). In another embodiment, the second CH3 region further comprises a modification of Y96F (IMGT; Y436F by EU).
[00098] In one embodiment, the second CH3 region is from a modified human IgG1, and further comprises a modification selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L358M, N384S, K392N , V397M, and V422I by EU).
[00099] In one embodiment, the second CH3 region is from a modified human IgG2, and further comprises a modification selected from the group consisting of N44S, K52N, and V82I (IMGT; N384S, K392N, and V422I by EU).
[000100] In one embodiment, the second CH3 region is from a modified human IgG4, and further comprises a modification selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT; Q355R, N384S , K392N, V397M, R409K, E419Q, and V422I by EU).
[000101] One method for producing an epitope binding protein that binds to more than one epitope is to immunize a first mouse according to the invention with an antigen comprising a first epitope of interest, wherein the mouse comprises a region locus endogenous immunoglobulin light chain variable that does not contain an endogenous mouse VL that is capable of rearrangement and formation of a light chain, where in the endogenous mouse immunoglobulin light chain variable region the locus is an operationally unique human VL gene segment linked to the endogenous mouse light chain constant region gene, and the human VL gene segment is selected from a human VK1-39JK5 and a human VK3-20JK1, and the endogenous mouse VH gene segments were replaced in whole or in part with human VH gene segments, such that the immunoglobulin heavy chains made by the mouse are exclusively or substantially heavy chains that comprise ndem human variable domains and mouse constant domains. When immunized, such a mouse will produce a reverse chimeric antibody comprising only one of the two variable domains of the human light chain (eg, one from human VK1-39JK5 or human VK3-20JK1). Once a B cell is identified that encodes a VH that binds to the epitope of interest, the VH nucleotide sequence (and, optionally, VL) can be retrieved (eg, by PCR) and cloned into an expression construct in the framework with a suitable human immunoglobulin constant domain. This process can be repeated to identify a second VH domain that binds to a second epitope, and a second VH gene sequence can be retrieved and cloned into an expression vector in frame with a suitable second immunoglobulin constant domain. The first and second immunoglobulin constant domains can be the same or different isotype, and one of the immunoglobulin constant domains (but not the other) can be modified as described in this application or in US 2010/0331527A1 , and the epitope binding protein can be expressed in a suitable cell and isolated based on its differential affinity for protein A compared to a homodimeric epitope binding protein, for example, as described in US 2010/0331527A1.
[000102] In one embodiment, a method for producing a bispecific epitope-binding protein is provided, comprising identifying a first affinity-matured human VH nucleotide sequence (VH1) (e.g. comprising one or more somatic hypermutations) of a mouse as described in this application, identifying a second affinity-matured human VH nucleotide sequence (VH2) (eg comprising one or more somatic hypermutations) from a mouse as described in this application, cloning VH1 in frame with a human heavy chain without a modification of protein A determinant as described in US 2010/0331527A1 for heavy chain form 1 (HC1), cloning VH2 in frame with a human heavy chain comprising a protein A determinant as described in US 2010/0331527A1 to form the heavy chain 2 (HC2), introducing an expression vector comprising HC1 and the same or different expression vector comprising HC 2 in a cell, wherein the cell also expresses a human immunoglobulin light chain comprising a human VK1-39/human jK5 or a human VK3-20/human jK1 fused to a human light chain constant domain, allowing the cell to express a bispecific epitope binding protein comprising a VH domain encoded by VH1 and a VH domain encoded by VH2, and isolating the bispecific epitope binding protein based on its differential ability to bind protein A compared to a binding protein to the monospecific homodimeric epitope. In a specific embodiment, HC1 is an IgG1, and HC2 is an IgG1 which comprises modification of H95R (IMGT; H435R by EU) and further comprises modification of Y96F (IMGT; Y436F by EU). In one embodiment, the VH-encoded VH domain, the VH2-encoded VH domain, or both, is somatically mutated.Human VH Genes Expressing with a Common Human VL
[000103] A variety of human variable regions of affinity-matured antibodies raised against four different antigens were expressed with their cognate light chain, or with at least one of a human light chain selected from human VK1-39JK5, human VK3-20JK1. , or human VpreBJÀ5 (see Example 1). For antibodies to each of the antigens, heavy chains from different, somatically mutated high-affinity gene families successfully paired with regions of rearranged human germline VK1-39JK5 and VK3-20JK1 and were secreted from cells expressing heavy and light chains. For VK1-39JK5 and VK3-20JK1, VH domains derived from the following human VH families expressed favorably: 1-2, 1-8, 1-24, 2-5, 3-7, 3-9, 3-11, 3- 13, 3-15, 3-20, 3-23, 3-30, 3-33, 3-48, 4-31, 4-39, 459, 5-51 and 6-1. Thus, a mouse that is bred to express a limited repertoire of human VL domains from one or both of VK1-39JK5 and VK3-20JK1 will generate a diverse population of somatically mutated human VH domains from a modified VH locus to replace VH gene segments of mouse with human VH gene segments.
[000104] Mice genetically engendered to express the chimeric (human variables, mouse constants) immunoglobulin reverse heavy chains associated with a single rearranged light chain (eg, VK1-39/J or VK3-20/J), when immunized with an antigen of interest, generated B cells that comprised a variety of human V-segment rearrangements and expressed a variety of high affinity antibodies specific for the antigen with diverse properties with respect to their ability to block the binding of the antigen to its ligand, and with respect to its ability to bind antigen variants (see Examples 5 to 10).
[000105] Thus, the mice and methods described in this application are useful in creating and selecting human immunoglobulin heavy chain variable domains, including somatically mutated human heavy chain variable domains, which result from a diversity of rearrangements, which exhibit a wide variety of affinities (including displaying a KD of approximately one nanomolar or less), a wide variety of specificities (including binding to different epitopes of the same antigen), and that associate and express with the same or substantially the same variable region of the human immunoglobulin light chain.
[000106] The following examples are provided to describe to those of ordinary skill in the art how to make and use methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to the numbers used (eg quantities, temperature, etc.), but some experimental errors and deviations must be accounted for. Unless otherwise noted, parts are parts by weight, molecular weight is average molecular weight, temperature is indicated in Centigrade, and pressure is atmospheric or near.EXAMPLESExample 1. Identification of human heavy chain variable regions that associate with selected human light chain variable regions
[000107] An in vitro expression system was constructed to determine whether a single rearranged human germline light chain can be co-expressed with human heavy chains of human antibodies specific for the antigen.
[000108] Methods for generating human antibodies in genetically modified mice are known (see eg US 6,596,541, Regeneron Pharmaceuticals, VELOCIMMUNE®). The VELOCIMMUNE® technology involves generating a genetically modified mouse having a genome comprising human heavy and light chain variable regions operatively linked to the endogenous mouse constant region loci such that the mouse produces an antibody comprising a human variable region and a region mouse constant in response to antigenic stimulation. The DNA encoding the heavy and light chain variable regions of antibodies produced from a VELOCIMMUNE® mouse is fully human. Initially, high-affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. As described below, antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. Mouse constant regions are replaced with a desired human constant region to generate a fully human antibody containing a non-IgM isotype, for example, wild or modified IgG1, IgG2, IgG3 or IgG4. While the selected constant region may vary according to specific use, high affinity antigen binding and target specificity characteristics reside in the variable region.
[000109] A VELOCIMMUNE® mouse was immunized with an angiogenesis-promoting growth factor (Antigen C) and human antibodies specific to the antigen were isolated and sequenced for use of the V gene using standard techniques recognized in the art. The selected antibodies were cloned to human heavy and light chain constant regions and 69 heavy chains were selected to pair with one of three human light chains: (1) the cognate K light chain linked to a human constant K region, (2) a rearranged human germline Vk1-39Jk5 linked to a human k constant region, or (3) a rearranged human germline Vk3-20Jk1 linked to a human k constant region. Each heavy chain and light chain pair were co-transfected into CHO-K1 cells using standard techniques. The presence of the antibody in the supernatant was detected by anti-human IgG in an ELISA assay. Antibody titer (ng/ml) was determined for each heavy chain/light chain pair and titers with the different rearranged germline light chains were compared to the titers obtained with the parent antibody molecule (i.e. heavy chain paired with the cognate light chain) and percent native titer were calculated (Table 1). VH: variable heavy chain gene. ND: no expression detected under current experimental conditions.




[000110] In a similar experiment, VELOCIMMUNE® mice were immunized with several different antigens and selected heavy chains of the antigen that the specific human antibodies were tested for their ability to pair with different rearranged human germline light chains (as described above). The antigens used in this experiment included an enzyme involved in cholesterol homeostasis (Antigen A), a serum hormone involved in the regulation of glucose homeostasis (Antigen B), a growth factor that promotes angiogenesis (Antigen C), and a receptor for cell surface (Antigen D). Antigen-specific antibodies were isolated from mice of each immunization group and variable regions of the heavy and light chain were cloned and sequenced. From the sequence of heavy and light chains, V gene usage was determined and selected heavy chains were paired with their cognate light chain or with a rearranged human germline region of VK1-39JK5. Each heavy/light chain pair was co-transfected into CHO-K1 cells and the presence of antibody in the supernatant was detected by anti-human IgG in an ELISA assay. Antibody titer (μg/ml) was determined for each heavy chain/light chain pairing and titers with the different rearranged human germline light chains were compared to the titers obtained with the parent antibody molecule (i.e. heavy chain paired with the cognate light chain) and percent native titer was calculated. (Table 2). VH: heavy chain variable gene. VK: K light chain variable gene. ND: no expression detected under current experimental conditions.


[000111] The results obtained from these experiments demonstrate that somatically mutated high-affinity heavy chains, from different gene families, are able to pair with VK1-39JK5 and VK3-20JK1 regions of rearranged human germline and be secreted from the cell as a molecule of normal antibody. As shown in Table 1, antibody titer was increased to approximately 61% (42 of 69) of heavy chains when paired with the rearranged human VK1-39JK5 light chain and approximately 29% (20 of 69) of heavy chains when paired with the light chain of rearranged human VK3-20JK1 compared to the cognate light chain of the parent antibody. For approximately 20% (14 of 69) of the heavy chains, both rearranged human germline light chains conferred an increase in expression compared to the cognate light chain of the parent antibody. As shown in Table 2, the rearranged human germline VK1-39JK5 region conferred an increase in the expression of several heavy chains specific for a range of different classes of antigens when compared to the cognate light chain of the parental antibodies. The antibody titer was increased by more than twice to approximately 35% (15/43) of the heavy chains when compared to the cognate light chain of the parental antibodies. For two heavy chains (315 and 316), the increase was greater than tenfold when compared to the parental antibody. Within all of the heavy chains that showed increased expression over the cognate light chain of the parent antibody, family of three heavy chains (VH3) are over-represented compared to other heavy chain variable region gene families. This demonstrates a favorable relationship of human VH3 heavy chains to pair with rearranged human germline VK1-39JK5 and VK3-20JK1 light chains. Example 2. Generation of a Rearranged Human Germination Lineage Light Chain Locus
[000112] Several rearranged human germline light chain targeting vectors have been made using VELOCIGENE® technology (see, for example, US Pat. No. 6,586,251 and Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21(6):652-659) to modify Bacterial Artificial Chromosome (BAC) clones from mouse genomic 302g12 and 254m04 (Invitrogen). Using these two BAC clones, genomic constructs were engineered to contain a single rearranged human germline light chain region and inserted into an endogenous K light chain locus that was previously modified to delete the endogenous K variable and join gene segments. THE. Construction of Rearranged Human Germination Lineage Light Chain Targeting Vectors
[000113] Three different rearranged human germline light chain regions were made using art-recognized standard molecular biology techniques. The human variable gene segments used to construct these three regions included the rearranged human VK1-39JK5 sequence, a rearranged human VK3-20JK1 sequence and a rearranged human VpreBJÀ5 sequence.
[000114] A DNA segment containing exon 1 (which encodes the leader peptide) and intron 1 of the mouse VK3-7 gene was made by de novo DNA synthesis (Integrated DNA Technologies). Part of the 5' untranslated region up to a naturally occurring BlpI restriction enzyme site was included. Exons from human genes VK1-39 and VK3-20 were amplified by PCR from human genomic BAC libraries. The sense primers had a 5' extension containing the intron 1 junction acceptor site of the mouse VK3-7 gene. The antisense primer used for PCR of the human VK1-39 sequence included an extension encoding human JK5, whereas the antisense primer used for PCR of the human VK3-20 sequence included an extension encoding human JK1. The human VpreBJÀ5 sequence was made by de novo DNA synthesis (Integrated DNA Technologies). A portion of the human JK-CK intron including the donor junction site was amplified by PCR from plasmid pBS-296-HA18-PISceI. The sense PCR primer included an extension coding part of a human sequence JK5, JK1 or JÀ5. The antisense primer included a PI-SCEI site, which was previously engineered into the intron.
[000115] Mouse exon1/intron 1 Vk3-7, human variable light chain exons, and human Jk-Ck intron fragments were joined by overlap extension PCR, digested with BlpI and PI-SceI, and ligated into plasmid pBS-296-HA18-PISceI, which contained the human Vk3-15 variable gene segment promoter. A hygromycin cassette with lox within plasmid pBS-296-HA18-PISceI was replaced with a hygromycin cassette with FRT flanked by NotI and AscI sites. The NotI/PI-SceI fragment of this plasmid was ligated into the modified mouse BAC 254m04, which contained the mouse JK-CK intron part, the mouse CK exon, and approximately 75 kb of the genomic sequence downstream of the mouse K locus which provided a 3' homology arm of homologous recombination in mouse ES cells. The NotI/AscI fragment from this BAC was then ligated into the modified mouse BAC 302g12, which contained a neomycin cassette with FRT and approximately 23 kb of genomic sequence upstream of the endogenous k locus for homologous recombination in mouse ES cells.B. Human Germinative Lineage VK1-39JK5 Targeting Vector Readjusted (Figure 1)
[000116] Restriction enzyme sites were introduced at the 5' and 3' ends of an engineered light chain insert for cloning into a targeting vector: an AscI site at the 5' end and a PI-SCEI site at the 3' end . Within the 5' AscI site and the 3' PI-SCEI site, the 5' to 3' targeting construct included a 5' homology arm containing the 5' sequence for the endogenous mouse k light chain locus obtained from the clone of mouse BAC 302g12, a neomycin resistance gene with FRT, a genomic sequence including the human Vk3-15 promoter, a mouse Vk3-7 variable gene segment leader sequence, an intron sequence from the mouse Vk3 variable gene segment -7, an open reading frame of a rearranged human germline Vk1-39Jk5 region, a genomic sequence containing a portion of the human Jk-Ck intron, and a 3' homology arm containing the 3' sequence of the Jk5 gene segment from endogenous mouse obtained from mouse BAC clone 254m04 (Figure 1, middle). Genes and/or sequences upstream of the endogenous mouse k light chain locus and downstream of most of the 3' JK gene segment (eg, endogenous 3' enhancer) were not modified by the targeting construct (see Figure 1). The sequence of the engineered human Vk1-39Jk5 locus is shown in SEQ ID NO:1.
The targeted insertion of the rearranged human germline Vk1-39Jk5 region into BAC DNA was confirmed by polymerase chain reaction (PCR) using primers located on sequences within the rearranged human germline light chain region. Briefly, the 3' intron sequence for the mouse Vk3-7 leader sequence was confirmed with primers ULC-m1F (AGGTGAGGGT ACAGATAAGT GTTATGAG; SEQ ID NO:2) and ULC-m1R (TGACAAATGC CCTAATTATA GTGATCA; SEQ ID NO:3) . The open reading frame of the rearranged human germline Vk1-39Jk5 region was confirmed with primers 1633-h2F (GGGCAAGTCAGAGCATTAGC A; SEQ ID NO:4) and 1633-h2R (TGCAAACTGGATGCAGCATA G; SEQ ID NO:5). The neomycin cassette was confirmed with primers neoF (ggtggagagg ctattcggc; SEQ ID NO:6) and neoR (gaacacggcg gcatcag; SEQ ID NO:7). Targeted BAC DNA was then used to electroporate mouse ES cells to modified ES cells created to generate chimeric mice expressing a rearranged human germline Vk1-39Jk5 region.
[000118] Positive ES cell clones were confirmed by screening with Taqman™ and karyotyping using probes specific for the engineered Vk1-39Jk5 light chain region inserted into the endogenous locus. Briefly, the neoP probe (TGGGCACAAC AGACAATCGG CTG; SEQ ID NO:8) which binds within the neomycin marker gene, ULC-m1P probe (CCATTATGAT GCTCCATGCC TCTCTGTTC; SEQ ID NO:9) which binds within the intron 3 sequence ' for the mouse VK3-7 leader sequence, and probe 1633h2P (ATCAGCAGAA ACCAGGGAAA GCCCCT; SEQ ID NO:10) which binds within the rearranged human germline VK1-39JK5 open reading frame. The positive ES cell clones were then used to implant female mice to give rise to a litter of pups expressing the germline VK1-39JK5 light chain region.
[000119] Alternatively, ES cells carrying the rearranged human germline VK1-39JK5 light chain region are transfected with a FLP expressing construct in order to remove the FRT neomycin cassette introduced by the targeting construct. Optionally, the neomycin cassette is removed by breeding to mice expressing FLP recombinase (eg, US 6,774,279). Optionally, the neomycin cassette is conserved in mice.C. Readjusted Human Germinative Lineage VK3-20JK1 Targeting Vector (Figure 2)
[000120] In a similar manner, an engineered light chain locus expressing a rearranged human germline VK3-20JK1 region was made using a targeting construct including, from 5' to 3', a 5' homology arm containing sequence 5' to the endogenous mouse light chain K locus obtained from mouse BAC clone 302g12, a neomycin resistance gene with FRT, a genomic sequence including the human Vk3-15 promoter, a mouse variable gene segment leader sequence Vk3-7, an intron sequence from the mouse variable gene segment Vk3-7, an open reading frame from a rearranged human germline Vk3-20Jk1 region, a genomic sequence containing a portion of the human JK-CK intron, and a 3' homology arm containing 3' sequence of the endogenous mouse JK5 gene segment obtained from mouse BAC clone 254m04 (Figure 2, middle). The sequence of the engineered human Vk3-20Jk1 locus is shown in SEQ ID NO:11.
The targeted insertion of the rearranged human germline Vk3-20Jk1 region into BAC DNA was confirmed by polymerase chain reaction (PCR) using primers located in sequences within the rearranged human germline Vk3-20Jk1 light chain region . Briefly, the 3' intron sequence for mouse Vk3-7 leader sequence was confirmed with primers ULC-m1F (SEQ ID NO:2) and ULC-m1R (SEQ ID NO:3). The open reading frame of the rearranged human germline Vk3-20Jk1 region was confirmed with primers 1635-h2F (TCCAGGCACC CTGTCTTTG; SEQ ID NO:12) and 1635-h2R (AAGTAGCTGC TGCTAACACT CTGACT; SEQ ID NO:13). The neomycin cassette was confirmed with neoF (SEQ ID NO:6) and neoR (SEQ ID NO:7) primers. Targeted BAC DNA was then used to electroporate the mouse ES cells to engineered ES cells to generate chimeric mice expressing the rearranged human germline Vk3-20Jk1 light chain.
[000122] Positive ES cell clones were confirmed by screening with Taqman™ and karyotyping using probes specific for the engineered Vk3-20Jk1 light chain region inserted into the endogenous k light chain locus. Briefly, neoP probe (SEQ ID NO:8) which binds within the neomycin marker gene, ULC-m1P probe (SEQ ID NO:9) which binds within the mouse Vk3-7 leader sequence, and the 1635h2P probe ( AAAGAGCCAC CCTCTCCTGC AGGG; SEQ ID NO:14) which binds within the human VK3-20JK1 open reading frame. The positive ES cell clones were then used to implant female mice. A litter of pups expressing the human germline VK3-20JK1 light chain region.
[000123] Alternatively, ES cells carrying the human germline VK3-20JK1 light chain region can be transfected with a FLP expressing construct in order to remove the introduced FRT neomycin cassette by targeting the construct. Optionally, the neomycin cassette can be removed by breeding to mice expressing FLP recombinase (e.g., US 6,774,279). Optionally, the neomycin cassette is conserved in mice.D. Readjusted Human Germinative Lineage VpreBJÀ5 Targeting Vector (Figure 3)
[000124] In a similar manner, an engineered light chain locus expressing a rearranged human germline VpreBJÀ5 region was made using a targeting construct including, from 5' to 3', a 5' homology arm containing 5' sequence for the endogenous mouse light chain K locus obtained from mouse BAC clone 302g12, a neomycin resistance gene with FRT, a genomic sequence including the human Vk3-15 promoter, a mouse variable gene segment leader sequence Vk3- 7, an intron sequence from the mouse variable gene segment Vk3-7, an open reading frame from a rearranged human germline VpreBJÀ5 region, a genomic sequence containing a portion of the human Jk-Ck intron, and a 3' homology arm containing 3' sequence of the endogenous mouse Jk5 gene segment obtained from mouse BAC clone 254m04 (Figure 3, middle). The sequence of the engineered human VpreBJÀ5 locus is shown in SEQ ID NO:15.
Targeted insertion of the rearranged human germline VpreBJÀ5 region into BAC DNA was confirmed by polymerase chain reaction (PCR) using primers located on sequences within the light chain region of rearranged human germline VpreBJÀ5 region. Briefly, the 3' intron sequence for the mouse VK3-7 leader sequence was confirmed with primers ULC-m1F (SEQ ID NO:2) and ULC-m1R (SEQ ID NO:3). The open reading frame of the rearranged human germline VpreBJÀ5 region was confirmed with primers 1616-h1F (TGTCCTCGGC CCTTGGA; SEQ ID NO:16) and 1616-h1R (CCGATGTCAT GGTCGTTCCT; SEQ ID NO:17). The neomycin cassette was confirmed with neoF (SEQ ID NO:6) and neoR (SEQ ID NO:7) primers. Targeted BAC DNA was then used to electroporate mouse ES cells to modified ES cells created to generate chimeric mice expressing the rearranged human germline VpreBJÀ5 light chain.
[000126] Positive ES cell clones are confirmed by Taqman™ screening and karyotyping using probes specific for the engineered VpreBJÀ5 light chain region inserted into the endogenous K light chain locus. Briefly, neoP probe (SEQ ID NO:8) which binds within the neomycin marker gene, ULC-m1P probe (SEQ ID NO:9) which binds within the mouse IgVk3-7 leader sequence, and the 1616h1P probe ( ACAATCCGCC TCACCTGCAC CCT; SEQ ID NO:18) which binds within the human VpreBJÀ5 open reading frame. The positive ES cell clones are then used to implant female mice to give rise to a litter of pups that express a region of the germline light chain.
[000127] Alternatively, ES cells carrying the rearranged human germline VpreBJÀ5 light chain region are transfected with a FLP expressing construct in order to remove the FRT neomycin cassette introduced by targeting the construct. Optionally, the neomycin cassette is removed by breeding to mice expressing FLP recombinase (eg, US 6,774,279). Optionally, the neomycin cassette is conserved in mice.Example 3. Generation of Mice Expressing a Single Rearranged Human Germinative Lineage Light Chain
[000128] The targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE® method (see, for example, US Pat. No. 7,294,754 and Poueymirou et al. (2007) F0 generation mice that are fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech.25 (1):91-99 VELOCIMICE® independently carrying a region of the germline VK1-39JK5 light chain engineered human, a VK3-20JK1 light chain region or a VpreBJÀ5 light chain region are identified by genotyping using a modification of the allele assay (Valenzuela et al., supra) that detects the presence of the human germline light chain region single rearranged.
[000129] The pups are genotyped and a pup heterozygous for the single rearranged human germline light chain region is selected for characterization of the expression of the rearranged human germline light chain region. Example 4. Breeding of Mice Expressing One Chain single rearranged human germline light A. Endogenous IgÀ Knockout (KO).
[000130] To optimize the use of the engineered light chain locus, mice carrying one of the rearranged human germline light chain regions are bred to another mouse containing a deletion in the endogenous À light chain locus. In this way, the progeny obtained will express, as its only light chain, the human germline light chain region rearranged as described in Example 2. The breeding is carried out by standard techniques recognized in the art and, alternatively, by a commercial breeder (by example, The Jackson Laboratory). Mouse strains that carry an engendered light chain locus and a deletion of the endogenous A light chain locus are screened for the presence of the single light chain region and the absence of the endogenous mouse À light chains.B. Humanized Endogenous Heavy Chain Locus.
[000131] Mice carrying an engendered human germline light chain locus are bred with mice containing a replacement of the endogenous mouse heavy chain variable gene locus with the human heavy chain variable gene locus (see US 6,596,541; mouse VELOCIMMUNE ®, Regeneron Pharmaceuticals, Inc). The VELOCIMMUNE® mouse comprises a genome comprising human heavy chain variable regions operatively linked to the endogenous mouse constant region loci such that the mouse produces antibodies comprising a human heavy chain variable region and a mouse heavy chain constant region in response to antigenic stimulation. DNA encoding antibody heavy chain variable regions is isolated and operatively linked to DNA encoding human heavy chain constant regions. The DNA is then expressed in a cell capable of expressing the fully human antibody heavy chain.
[000132] Mice carrying a replacement of the endogenous mouse VH locus with the human VH locus and a rearranged human germline single VL region in the endogenous K light chain locus are obtained. Reverse chimeric antibodies containing somatically mutated heavy chains (human VH and mouse CH) with a single human light chain (human VL and mouse CL) are obtained upon immunization with an antigen of interest. The VH and VL nucleotide sequences of B cells expressing the antibodies are identified and fully human antibodies are made by fusion, VH and VL nucleotide sequences to human CH and CL nucleotide sequences in a suitable expression system.Example 5. Generation of Antibodies of Mice Expressing Human Heavy Chains and a Region of the Readjusted Human Germinative Lineage Light Chain
[000133] After breeding mice containing the human light chain region engendered various desired strains containing modifications and deletions of other endogenous Ig loci (as described in Example 4), selected mice can be immunized with an antigen of interest.
[000134] Generally, a VELOCIMMUNE® mouse containing one of the unique rearranged human germline light chain regions is challenged with an antigen, and lymph cells (such as B cells) are recovered from the animals' serum. Lymphatic cells are fused with a myeloma cell line to prepare immortal hybridoma cell lines, and such hybridoma cell lines are screened and selected to identify hybridoma cell lines that produce antibodies that contain human heavy chain variables and lineage light chains human germ cells that are specific for the antigen used for immunization. DNA encoding the heavy and light chain variable regions is isolated and ligated to desirable isotypic heavy chain and light chain constant regions. Due to the presence of the endogenous mouse sequences and any additional cis-acting elements present at the endogenous locus, the unique light chain of each antibody can be somatically mutated. This adds additional diversity to the antigen-specific repertoire comprising a single light chain and diverse heavy chain sequences. The resulting cloned antibody sequences are further expressed in a cell, such as a CHO cell. Alternatively, DNA encoding the antigen-specific chimeric antibodies or light and heavy chain variable domains is identified directly from antigen-specific lymphocytes.
[000135] Initially, high affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. As described above, antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. The mouse constant regions are replaced with a desired human constant region to generate the fully human antibody containing a somatically mutated human heavy chain and a single light chain derived from a rearranged human germline light chain region of the invention. Suitable human constant regions include, for example, wild-type or modified IgG1 or IgG4.
[000136] Separate cohorts of VELOCIMMUNE® mice containing a replacement of the endogenous mouse heavy chain locus with human gene segments V, D and J and a replacement of the endogenous mouse light chain K locus with the human light chain VK1 region Germline engendered -39JK5 or with human germline engendered light chain region Vk3-20Jk1 (described above) were immunized with a human cell surface receptor protein (Antigen E). Antigen E is administered directly into the rear plantar pad of mice with six consecutive injections every 3-4 days. Two to three micrograms of Antigen E is mixed with 10 μg of CpG oligonucleotide (Cat # tlrl-modn - oligonucleotide ODN1826; InVivogen, San Diego, CA) and 25 μg of Adju-Phos (aluminum phosphate gel adjuvant, Cat# H -71639-250; Brenntag Biosector, Frederikssund, Denmark) before injection. A total of six injections are given before final antigen recall, which is given 3-5 days before sacrifice. Haemorrhages after the 4th and 6th injection are collected and the antibody immune response is monitored by a standard antigen-specific immunoassay.
[000137] When a desired immune response is achieved, splenocytes are collected and fused with mouse myeloma cells to conserve their viability and form hybridoma cell lines. Hybridoma cell lines are screened and selected to identify cell lines that produce Antigen-specific common light chain antibodies. Using this technique, several common anti-E antigen specific light chain antibodies (ie, antibodies that have human heavy chain variable domains, the same human light chain variable domain, and mouse constant domains) are obtained.
[000138] Alternatively, anti-E antigen common light chain antibodies are isolated directly from antigen-positive B cells without fusion to myeloma cells, as described in U.S. 2007/0280945A1, this application specifically incorporated by reference in its entirety. Using this method, various fully human anti-E antigen common light chain antibodies (i.e., antibodies that have human heavy chain variable domains, an engineered human VK1-39JK5 light chain or an engineered human VK3-20JK1 light chain region, and domains human constants) were obtained.
[000139] Exemplary biological properties of anti-E antigen common light chain antibodies generated by the methods of this Example are described in detail in the sections presented below.Example 6. Use of Heavy Chain Gene Segment in Antigen-specific Common Light Chain Antibodies
[000140] To analyze the structure of human anti-E antigen common light chain antibodies produced, nucleic acids encoding heavy chain antibody variable regions were cloned and sequenced. From the nucleic acid sequences and predicted amino acid sequences of the antibodies, gene use was identified for the heavy chain variable region (HCVR) of selected common light chain antibodies obtained from mice immunized with VELOCIMMUNE® containing the human VK1-39JK5 light chain engineered or engineered human VK3-20JK1 light chain region. The results are shown in Tables 3 and 4, which demonstrate that mice according to the invention generate common light chain antibodies specific for the antigen of a variety of human heavy chain gene segments, due to a variety of rearrangements, employing a mouse expressing a light chain of only a human VK1-39- or a human-derived VK3-20 light chain. The human VH gene segments from families 2, 3, 4, and 5 rearranged with a variety of human segments from human segments DH and JH to produce antibodies specific to the antigen.

Example 7. Determination of Ability to Block Antigen-Specific Common Light Chain Antibodies by Luminex™ Assay
[000141] Ninety-eight human common light chain antibodies that reacted against E-Antigen were tested for their ability to block the binding of the natural E-Antigen ligand (Y-Ligand) to E-Antigen in a bead-based assay.
[000142] The extracellular domain (ECD) of Antigen E was conjugated to two myc epitope tags and a 6X histidine tag (E-mmH Antigen) and coupled with amine to carboxylated microspheres at a concentration of 20 μg/mL in MES buffer . The mixture was incubated for two hours at room temperature followed by bead deactivation with 1M Tris pH 8.0 followed by washing in PBS with 0.05% (v/v) Tween-20. The beads were then blocked with PBS (Irvine Scientific, Santa Ana, CA) containing 2% (w/v) BSA (Sigma-Aldrich Corp., St. Louis, MO). In a 96-well filter plate, supernatants containing Antigen E-specific common light chain antibodies were diluted 1:15 in buffer. A negative control containing a sham supernatant with the same media components as for the antibody supernatant was prepared. Antigen E-labeled beads were added to supernatants and incubated overnight at 4°C. Biotinylated ligand Y protein was added to a final concentration of 0.06 nM and incubated for two hours at room temperature. Detection of biotinylated Y-ligand bound to E-myc-myc-6His Antigen-tagged beads was determined with Streptavidin-conjugated R-phycoerythrin (Moss Inc, Pasadena, MD) followed by measurement on a flow analyzer based on Luminex™ cytometry. Background Mean Fluorescence Intensity (MFI) of a sample without Ligand Y was subtracted from all samples. Percent block was calculated by dividing the MFI subtracted from the background of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[000143] In a similar experiment, the same 98 common human light chain antibodies raised against Antigen E were tested for their ability to block the binding of Antigen E to Y Ligand-labeled beads.
[000144] Briefly, Ligand Y was amine-coupled to carboxylated microspheres at a concentration of 20 μg/ml diluted in MES buffer. The mixture is incubated two hours at room temperature followed by deactivation of beads with 1M Tris pH 8 then washing in PBS with 0.05% (v/v) Tween-20. The beads were then blocked with PBS (Irvine Scientific, Santa Ana, CA) containing 2% (w/v) BSA (Sigma-Aldrich Corp., St. Louis, MO). In a 96-well filter plate, supernatants containing Antigen E-specific common light chain antibodies were diluted 1:15 in buffer. A negative control containing a sham supernatant with the same media components as the antibody supernatant was prepared. A biotinylated E-mmH antigen was added to a final concentration of 0.42 nM and incubated overnight at 4°C. The Ligand Y-labeled beads were then added to the Antibody/Antigen E mixture and incubated for two hours at room temperature. Detection of Biotinylated E-mmH antigen bound to Ligand Y-beads was determined with R-Phycoerythrin conjugated to Streptavidin (Moss Inc, Pasadena, MD) followed by measurement on a flow analyzer based on Luminex™ cytometry. Background Mean Fluorescence Intensity (MFI) of a sample without E-Antigen was subtracted from all samples. Percent block was calculated by dividing the MFI subtracted from the background of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[000145] Tables 5 and 6 show 98 percent blocking of common light chain E antigen antibodies tested in both Luminex™ assays. ND: not determined under current experimental conditions.
[000146] In the first Luminex™ experiment described above, 80 common light chain antibodies containing the engineered light chain VK1-39JK5 were tested for their ability to block Ligand Y binding to Antigen E-labeled beads. common mild, 68 demonstrated >50% block, while 12 demonstrated <50% block (6 in 25-50% block and 6 in <25% block). Since 18 common light chain antibodies contained the engineered VK3-20JK1 light chain, 12 demonstrated >50% blockade, while 6 demonstrated <50% blockade (3 in 25-50% block and 3 in <25% block) of Ligand Y binding to E-Antigen-labelled beads.
[000147] In the second Luminex™ experiment described above, the same 80 common light chain antibodies containing the engineered light chain VK1-39JK5 were tested for their ability to block the binding of E-Antigen to Y Ligand-labeled beads. common light chain, 36 demonstrated >50% block, while 44 demonstrated <50% block (27 in 25-50% block and 17 in <25% block). Since 18 common light chain antibodies containing the engendered VK3-20JK1 light chain, 1 demonstrated >50% blockade, while 17 demonstrated <50% blockade (5 in 25-50% blockade and 12 in <25% blockade) ) of E-Antigen binding to Y-Linker-labeled beads.
[000148] The data in Tables 5 and 6 establish that the rearrangements described in Tables 3 and 4 generated anti-E-specific common light chain antibodies that blocked the binding of Ligand Y to its cognate receptor E-Antigen with varying degrees of efficacy, which is compatible with anti-E antigen common light chain antibodies of Tables 3 and 4 which comprise antibodies with overlapping and non-overlapping epitope specificity with respect to E-Antigen.




Example 8. Determination of Blocking Capability of Antigen-Specific Common Light Chain Antibodies by ELISA
[000149] Human common light chain antibodies raised against Antigen E were tested for their ability to block Antigen E by binding to a surface coated with Ligand Y in an ELISA assay.
[000150] Ligand Y was coated in 96-well plates at a concentration of 2 μg/ml diluted in PBS and incubated overnight followed by washing four times in PBS with 0.05% Tween-20. The plate was then blocked with PBS (Irvine Scientific, Santa Ana, CA) containing 0.5% (w/v) BSA (Sigma-Aldrich Corp., St. Louis, MO) for one hour at room temperature. On a separate plate, supernatants containing common light chain anti-E antigen antibodies were diluted 1:10 in buffer. A sham supernatant with the same antibody components was used as a negative control. Antigen E-mmH (described above) was added to a final concentration of 0.150 nM and incubated for one hour at room temperature. The Antibody/Antigen E-mmH mixture was then added to the plate containing Ligand Y and incubated for one hour at room temperature. The detection of E-mmH Antigen linked to Y Ligand was determined with Horseradish Peroxidase (HRP) conjugated to anti-Penta-His antibody (Qiagen, Valencia, CA) and developed by standard colorimetric response using tetramethylbenzidine (TMB) substrate ( BD Biosciences, San Jose, CA) neutralized by sulfuric acid. Absorbance was read at OD450 for 0.1 second. The background absorbance of a sample without E-Antigen was subtracted from all samples. Percent block was calculated by dividing the MFI subtracted from the background of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[000151] Tables 7 and 8 show 98 percent blocking of common anti-E antigen light chain antibodies tested in the ELISA assay. ND: not determined under current experimental conditions.
[000152] As described in this Example, of 80 common light chain antibodies containing engineered VK1-39JK5 light chain tested for their ability to block E-Antigen by binding to a surface coated with Ligand Y, 22 demonstrated >50% blocking , while 58 demonstrated <50% block (20 in 25-50% block and 38 in <25% block). Since 18 common light chain antibodies containing the engineered light chain VK3-20JK1 , 1 demonstrated >50% blockade, while 17 demonstrated <50% blockade (5 in 25-50% block and 12 in <25% blockade ) of Antigen E binding to a surface coated with Ligand Y.
[000153] These results are also compatible with the common light chain antibody grouping Antigen E-specific comprising antibodies with overlapping and non-overlapping epitope specificity with respect to Antigen E.



Example 9. BIAcore™ Affinity Determination of Antigen-Specific Common Light Chain Antibodies
[000154] Equilibrium dissociation constants (KD) of selected antibody supernatants were determined by SPR (Surface Plasmon Resonance) using a BIAcore™ T100 instrument (GE Healthcare). All data were obtained using HBS-EP (10 mM Hepes, 150 mM NaCl, 0.3 mM EDTA, 0.05% Surfactant P20, pH 7.4) as both running and sample buffers at 25°C. Antibodies were captured from crude supernatant samples onto a previously derived CM5 sensor chip surface with a high density of anti-human Fc antibodies using standard amine coupling chemistry. During the capture step, supernatants were injected through the anti-human Fc surface at a flow rate of 3 µL/min, for a total of 3 minutes. The capture step was followed by an injection of running buffer or analyte at a concentration of 100 nM for 2 minutes at a flow rate of 35 µL/min. Dissociation of antigen from the captured antibody was monitored for 6 minutes. Captured antibody was removed by a brief injection of 10 mM glycine, pH 1.5. All sensorgrams were doubly referenced by subtracting buffer injection sensorgrams from analyte sensorgrams, thereby removing artifacts caused by dissociation of antibody from the capture surface. Binding data for each antibody was fitted to a 1:1 mass transport binding model using BIAcore T100 Evaluation v2.1 program. The results are shown in Tables 9 and 10.
[000155] The binding affinities of common light chain antibodies comprising the rearrangements shown in Tables 3 and 4 vary, with almost all exhibiting a KD in the nanomolar range. Affinity data are compatible with common light chain antibodies that result from the combinatorial association of rearranged variable domains described in Tables 3 and 4 that are high affinity, clonally selected, and somatically mutated. Coupled with data previously shown, the common light chain antibodies described in Tables 3 and 4 comprise a collection of several high-affinity antibodies that exhibit specificity to one or more epitopes on the E-Antigen.



Example 10. Determination of Antigen-Specific Common Light Chain Antibody Binding Specificities by Luminex™ Assay
[000156] Selected anti-E antigen common light chain antibodies were tested for their ability to bind to Antigen E ECD and Antigen E ECD variants, including the cynomolgus monkey ortholog (Antigen E Mf), which differentiates from the human protein in approximately 10% of its amino acid residues; an E-Antigen deletion mutant lacking the last 10 amino acids from the C-terminal end of ECD (E-ΔCT Antigen); and two mutants containing an alanine substitution at positions suspected of interacting with Ligand Y (E-Ala1 Antigen and E-Ala2 Antigen). Antigen E proteins were produced in CHO cells and each contained a C-terminal myc-myc-His tag.
[000157] For binding studies, Antigen E ECD protein or protein variant (described above) from 1 ml of culture medium was captured by incubation for 2 hours at room temperature with 1 x 106 microsphere beads (Luminex™) covalently coated with an anti-myc monoclonal antibody (MAb 9E10, CRL-1729™ hybridoma cell line; ATCC, Manassas, VA). The beads were then washed with PBS prior to use. Supernatants containing anti-E antigen common light chain antibodies were diluted 1:4 in buffer and added to 96-well filter plates. A sham supernatant without antibody was used as a negative control. The beads containing captured Antigen E proteins were then added to the antibody samples (3000 beads per well) and incubated overnight at 4°C. The next day, the sample beads were washed and bound common light chain antibody was detected with the anti-human IgG antibody conjugated to an R-phycoerythrin. The fluorescence intensity of the beads (approximately 100 beads counted for each antibody sample that binds to each Antigen E protein) was measured with an analyzer based on Luminex™ flow cytometry, and the median fluorescence intensity (MFI) of fur least 100 accounts counted per account/antibody interaction was recorded. The results are shown in Tables 11 and 12.





[000158] Common light chain antigen E antibody supernatants exhibited high specific binding to E-ECD Antigen-bound beads. For these beads, the sham negative control supernatant resulted in negligible signal (<10 MFI) when combined with the E-ECD Antigen bead sample, whereas supernatants containing common light chain antibodies to antigen E exhibited strong binding signal (MFI mean 2627 for 98 antibody supernatants; MFI > 500 for 91/98 antibody samples).
[000159] As a measure of the ability of selected anti-E antigen common light chain antibodies to identify different epitopes on the E-Antigen ECD, the relative binding of the antibodies to the variants was determined. All four E-Antigen variants were captured with Luminex™ anti-myc beads as described above for Native E-ECD antigen binding studies, and the relative binding ratios (MFIvariant/MFI-E-ECD antigen) were determined. For 98 tested common light chain antibody supernatants shown in Tables 11 and 12, the mean ratios (MFIvariant/MFIantigen E-ECD) differed for each variant, likely reflecting different capture amounts of proteins in the beads (mean ratios of 0 .61, 2.9, 2.0, and 1.0 for E-ΔCT Antigen, E-Ala1 Antigen, E-Ala2 Antigen, and Mf E Antigen, respectively). For each protein variant, binding of a subset of 98 common light chain antibodies tested showed very low binding, indicating sensitivity to the mutation that characterized a given variant. For example, 19 of the common light chain antibody samples bound to Mf E Antigen with MFIvariant/MFIA E-ECD Antigen of <8%. Since many in this group include high or moderately high affinity antibodies (5 with KD <5nM, 15 with KD <50nM), it is likely that the lowest signal in this group results from sensitivity to sequence (epitope) differences between the Native E-antigen ECD is a given variant rather than lower affinities.
[000160] These data establish that the common light chain antibodies described in Tables 3 and 4 in fact represent a diverse group of common light chain antibodies specific for the E Antigen that specifically recognize more than one epitope on the E Antigen.

权利要求:
Claims (36)
[0001]
1. A method of selecting a human heavy chain variable region nucleic acid sequence to produce an antibody, the method characterized in that it comprises: obtaining one or more human heavy chain variable region nucleic acid sequences from a mouse B cell, wherein the B cell produces an antibody that binds to an antigen of interest, wherein the mouse has a germline genome comprising: (a) a single human immunoglobulin light chain variable region rearranged in the Mouse Kendogen immunoglobulin light chain variable region locus, wherein the only rearranged human immunoglobulin light chain variable region is a rearranged human Vk1-39/Jk sequence, wherein the rearranged human Vk1-39/Jk sequence comprises a single germline Vk1-39 segment and a single germline Jk segment, or a rearranged human Vk3-20/Jk sequence, wherein the human VK3-20/JK sequence r The arranged comprises a single germline segment Vk3-20 and a single germline segment Jk; and, (b) a replacement or insertion of endogenous heavy chain variable gene segments with one or more human VH gene segments, wherein the human VH gene segments are operably linked to an endogenous constant heavy chain region gene, and the segments Human VH genes are able to rearrange and form a human/mouse chimeric heavy chain gene.
[0002]
2. Method according to claim 1, characterized in that mouse B cells express a population of antibodies that all contain the same light chain or somatic mutated variants thereof, paired with a population of different heavy chains.
[0003]
3. Method according to claim 1, characterized in that the obtaining step comprises obtaining a clonally selected B cell from a mouse, having the mouse: (a) been immunized with the antigen of interest; and(b) allowed to develop an immune response to the antigen of interest; wherein the B cell expresses an antibody that specifically binds to the antigen of interest.
[0004]
4. Method according to any one of claims 1 to 3, characterized in that the antibody is a bispecific antibody.
[0005]
5. Method according to any one of claims 1 to 4, characterized in that the mouse comprises an immunoglobulin light chain variable region locus that does not comprise an endogenous VK gene segment that is capable of rearranging and forming a gene of the immunoglobulin light chain.
[0006]
6. Method according to any one of claims 1 to 5, characterized in that the mouse comprises a mouse intronic k enhancer and/or a mouse k 3' enhancer.
[0007]
7. Method according to any one of claims 1 to 6, characterized in that the single rearranged human immunoglobulin light chain variable region is operatively linked to a mouse light chain constant region.
[0008]
8. Method according to claim 7, characterized in that the mouse light chain constant region is a kappa light chain constant region.
[0009]
9. Method according to any one of claims 1 to 8, characterized in that the one or more human VH gene segments comprise between 19 and 81 unrearranged human VH gene segments.
[0010]
10. Method according to any one of claims 1 to 8, characterized in that the one or more human VH gene segments comprise between 12 and 43 functional human VH gene segments.
[0011]
11. Method according to any one of claims 1 to 10, characterized in that the one or more human VH gene segments are selected from among VH1-2, VH1-8, VH1-18, VH1-24, VH2-5, VH3-7, VH3-9, VH3-11, VH3-13, VH3-15, VH3-20, VH3-23, VH3-30, VH3-33, VH3-43, VH3-48, VH4-31, VH4- 34, VH4-59, VH6-1, or a combination of these.
[0012]
12. Method according to any one of claims 1 to 11, characterized in that the mouse germline genome further comprises at least one unrearranged human D gene segment and at least one unrearranged human J gene segment.
[0013]
13. Method according to claim 12, characterized in that at least one unrearranged human D gene segment is selected from among D1-7, D1-26, D3-3, D3-10, D3-16, D3-22 , D5-5, D5-12, D6-6, D6-13, D7-27 or a combination thereof.
[0014]
14. Method according to claim 12 or 13, characterized in that the at least one unrearranged human J gene segment is selected from among J1, J3, J4, J5, J6, or a combination thereof.
[0015]
15. Method according to any one of claims 1 to 14, characterized in that the single rearranged human immunoglobulin light chain variable region comprises a rearrangement of a human VK1-39 gene segment and a human JK5 gene segment.
[0016]
16. Method according to any one of claims 1 to 14, characterized in that the only rearranged human immunoglobulin light chain variable region comprises a rearrangement of a human VK3-20 gene segment and a human JK1 gene segment.
[0017]
17. Method according to claim 4, characterized in that the variable domains of the human heavy chain of the bispecific antibody bind to: (a) two different antigens; or (b) two different epitopes from the same antigen.
[0018]
18. A method of making an antibody, characterized in that it comprises: (a) culturing a cell containing (i) a first nucleic acid sequence encoding a first immunoglobulin heavy chain, wherein the first nucleic acid sequence comprises a first human heavy chain variable region sequence encoding a first human heavy chain variable domain recognizing a first epitope; (ii) a second nucleic acid sequence encoding a second immunoglobulin heavy chain wherein the second nucleic acid sequence comprises a second human heavy chain variable region sequence encoding a second human heavy chain variable domain that recognizes a second epitope; (iii) a third nucleic acid sequence encoding an immunoglobulin light chain wherein the third acid sequence Nucleic comprises a human light chain variable region sequence encoding a variable domain. the human light chain, wherein the immunoglobulin light chain pairs with the first and second immunoglobulin heavy chains; under conditions that allow the cell to express the first and second immunoglobulin heavy chains and the immunoglobulin light chain to generate the antibody; and (b) isolating the antibody from the cell; wherein the first and second heavy chain variable region sequences are obtained from a mouse, whose germline genome comprises: (iv) a single rearranged human immunoglobulin light chain variable region (VK/JK) encoding a human VK domain of an immunoglobulin light chain, wherein the single rearranged human Vk/Jk region is selected from a human Vk1-39/J sequence or a human Vk3-20/J sequence; and, (v) a replacement of endogenous heavy chain (VH) variable gene segments with one or more human VH gene segments, wherein the human VH gene segments are operably linked to an endogenous heavy chain constant region gene, and the Human VH gene segments are able to rearrange and form a human/mouse chimeric heavy chain gene.
[0019]
19. Method according to claim 18, characterized in that the mouse does not have mouse immunoglobulin Vk and/or Jk segment(s).
[0020]
20. Method according to claim 18, characterized in that the mouse does not express functional endogenous immunoglobulin heavy and light k chains.
[0021]
21. Method according to any one of claims 18 to 20, characterized in that the mouse comprises a mouse intronic K enhancer and/or a mouse K 3' enhancer.
[0022]
22. Method according to any one of claims 18 to 21, characterized in that the single rearranged human immunoglobulin light chain variable region is operatively linked to a mouse light chain constant region.
[0023]
23. Method according to claim 22, characterized in that the mouse light chain constant region is a kappa light chain constant region.
[0024]
24. Method according to any one of claims 18 to 23, characterized in that the one or more human VH gene segments of (v) comprise between 19 and 81 unrearranged human VH gene segments.
[0025]
25. Method according to any one of claims 18 to 23, characterized in that the one or more human VH gene segments of (v) comprise between 12 and 43 functional human VH gene segments.
[0026]
26. Method according to any one of claims 18 to 25, characterized in that the one or more human VH gene segments of (v) are selected from among VH1-2, VH1-8, VH1-18, VH1-24, VH2-5, VH3-7, VH3-9, VH3-11, VH3-13, VH3-15, VH3-20, VH3-23, VH3-30, VH3-33, VH3-43, VH3-48, VH4- 31, VH4-34, VH4-59, VH6-1 or a combination thereof.
[0027]
27. Method according to any one of claims 18 to 26, characterized in that the mouse germline genome further comprises at least one unrearranged human D gene segment and at least one unrearranged human J gene segment.
[0028]
28. Method according to claim 27, characterized in that the at least one unrearranged human gene segment D is selected from among D1-7, D1-26, D3-3, D310, D3-16, D3-22, D5-5, D5-12, D6-6, D6-13, D7-27 or a combination thereof.
[0029]
29. Method according to claim 27, characterized in that the at least one unrearranged human J gene segment is selected from among J1, J3, J4, J5, J6, or a combination thereof.
[0030]
30. Method according to claim 18, characterized in that the single VK/JK region rearranged in (iv) comprises a rearrangement of a human VK1-39 gene segment and a human Jk5 gene segment.
[0031]
31. Method according to claim 18, characterized by the fact that the only human Vk/Jk region rearranged in (iv) comprises a rearrangement of a human gene segment Vk3-20 and a human gene segment Jk1.
[0032]
32. Method according to any one of claims 18 to 31, characterized in that the first and second epitopes are on different antigens.
[0033]
33. Method according to any one of claims 18 to 31, characterized in that the first and second epitopes are on the same antigen.
[0034]
34. Method according to any one of claims 18 to 31, characterized in that the first and second epitopes are the same.
[0035]
A method according to any one of claims 18 to 34, characterized in that the first nucleic acid sequence comprises the first human heavy chain variable region sequence fused to a human heavy chain constant region sequence, the second sequence of Nucleic acid comprises the second human heavy chain variable region sequence fused to a human heavy chain constant region sequence, and the third nucleic acid sequence comprises the human light chain variable region sequence fused to a human heavy chain constant region sequence light human.
[0036]
36. Method according to claim 32, characterized in that the antibody is a fully human antibody.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP6470789B2|2019-02-13|Common light chain mice

---

AU2016202488B2|2018-04-05|Common light chain mouse

---

NL2012424C2|2014-12-08|Common light chain mouse.

---

AU2018201014B2|2020-10-29|Common light chain mouse

---

AU2014200245B2|2016-06-02|Common light chain mouse

同族专利:

---

公开号 | 公开日

---

SG10201913463QA|2020-03-30|

---

KR20130010110A|2013-01-25|

---

NZ619512A|2014-10-31|

---

CA2789154A1|2011-08-11|

---

SI2501817T1|2015-12-31|

---

LT3095871T|2019-05-27|

---

BR122014002928A2|2015-12-29|

---

JP5955781B2|2016-07-20|

---

EP3095871B1|2019-04-10|

---

MX2012009168A|2012-08-31|

---

ZA201205944B|2013-06-26|

---

IL267362D0|2019-08-29|

---

JP2022001066A|2022-01-06|

---

JP2017140050A|2017-08-17|

---

CN102791866A|2012-11-21|

---

TR201906650T4|2019-05-21|

---

ES2547142T5|2021-12-09|

---

CY1118241T1|2017-06-28|

---

IL290085D0|2022-03-01|

---

AU2011213585A1|2012-08-30|

---

ES2603559T5|2021-02-22|

---

EP2505654B1|2016-08-24|

---

HRP20151188T1|2015-12-04|

---

JP2015171386A|2015-10-01|

---

EP2501817B2|2021-04-21|

---

SMT201500283B|2016-01-08|

---

CN102791866B|2015-07-29|

---

NZ601679A|2014-01-31|

---

SI2505654T1|2016-12-30|

---

ME02288B|2016-02-20|

---

RU2724663C2|2020-06-25|

---

RS59001B1|2019-08-30|

---

KR101995735B1|2019-07-03|

---

RU2015147726A3|2019-06-25|

---

HRP20191191T1|2019-10-04|

---

JP2018138047A|2018-09-06|

---

ES2603559T3|2017-02-28|

---

JP6470789B2|2019-02-13|

---

EP2505654A1|2012-10-03|

---

KR20190077630A|2019-07-03|

---

US20120192300A1|2012-07-26|

---

EP3095871A1|2016-11-23|

---

RS54367B1|2016-04-28|

---

IL221265A|2020-04-30|

---

US20210204531A1|2021-07-08|

---

BR112012019887A2|2015-09-15|

---

DK2501817T3|2015-12-07|

---

KR102283195B1|2021-07-29|

---

PL3095871T3|2019-10-31|

---

EP2501817A1|2012-09-26|

---

PT2505654T|2016-11-18|

---

SG10201610294RA|2017-02-27|

---

JP2020096633A|2020-06-25|

---

ES2728942T3|2019-10-29|

---

KR101829691B1|2018-02-19|

---

DK3095871T3|2019-06-11|

---

PL2501817T5|2021-08-16|

---

JP2019076108A|2019-05-23|

---

PT2501817E|2015-11-04|

---

RS55315B2|2020-08-31|

---

SG10201500821UA|2015-04-29|

---

JP6666483B2|2020-03-13|

---

EP2505654B2|2020-05-13|

---

SMT201600432B|2017-01-10|

---

LT2505654T|2016-12-12|

---

IL221265D0|2012-10-31|

---

PL2505654T5|2020-11-30|

---

ES2547142T3|2015-10-02|

---

HRP20161551T4|2020-10-02|

---

CN105010238A|2015-11-04|

---

NZ631363A|2016-05-27|

---

ME02646B|2017-06-20|

---

US10143186B2|2018-12-04|

---

RS55315B1|2017-03-31|

---

EP2501817B1|2015-08-26|

---

US20130302836A1|2013-11-14|

---

JP2013518597A|2013-05-23|

---

HUE029785T2|2017-04-28|

---

SI2501817T2|2021-09-30|

---

EP3540066A1|2019-09-18|

---

DK2501817T4|2021-07-26|

---

HRP20161551T1|2016-12-30|

---

AU2011213585B2|2014-02-06|

---

RU2571205C2|2015-12-20|

---

HK1174358A1|2013-06-07|

---

HRP20151188T4|2021-10-01|

---

WO2011097603A1|2011-08-11|

---

KR20210095730A|2021-08-02|

---

RS54367B2|2021-08-31|

---

JP6960005B2|2021-11-05|

---

SG183149A1|2012-09-27|

---

RU2015147726A|2019-01-15|

---

MX350983B|2017-09-27|

---

US20110195454A1|2011-08-11|

---

HUE045591T2|2019-12-30|

---

KR20200060534A|2020-05-29|

---

US10986820B2|2021-04-27|

---

HK1231505A1|2017-12-22|

---

RU2012138431A|2014-03-20|

---

DK2505654T4|2020-07-27|

---

PL2501817T3|2016-02-29|

---

KR102116296B1|2020-05-28|

---

CN105010238B|2018-07-20|

---

JP6215264B2|2017-10-18|

---

IL267362A|2022-02-01|

---

SI2505654T2|2020-08-31|

---

HUE026229T2|2016-06-28|

---

US20190040123A1|2019-02-07|

---

SI3095871T1|2019-06-28|

---

PT3095871T|2019-06-12|

---

MY166529A|2018-07-10|

---

PL2505654T3|2017-02-28|

---

KR20180018838A|2018-02-21|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

AT190355T|1988-09-06|2000-03-15|Xoma Corp|GENEXPRESSION ELEMENTS AND PRODUCTION OF CHIMERAL MOUSE-HUMAN ANTIBODIES|

---

GB8823869D0|1988-10-12|1988-11-16|Medical Res Council|Production of antibodies|

---

WO1991000906A1†|1989-07-12|1991-01-24|Genetics Institute, Inc.|Chimeric and transgenic animals capable of producing human antibodies|

---

US5574205A|1989-07-25|1996-11-12|Cell Genesys|Homologous recombination for universal donor cells and chimeric mammalian hosts|

---

US5959177A|1989-10-27|1999-09-28|The Scripps Research Institute|Transgenic plants expressing assembled secretory antibodies|

---

CA2075206C|1989-12-01|2006-05-23|Herbert L. Heyneker|Production of recombinant polypeptides by bovine species and transgenic methods|

---

US6150584A|1990-01-12|2000-11-21|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

US6713610B1|1990-01-12|2004-03-30|Raju Kucherlapati|Human antibodies derived from immunized xenomice|

---

EP0652950B1|1992-07-24|2007-12-19|Amgen Fremont Inc.|Generation of xenogeneic antibodies|

---

US6657103B1|1990-01-12|2003-12-02|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

AU633698B2|1990-01-12|1993-02-04|Amgen Fremont Inc.|Generation of xenogeneic antibodies|

---

US6075181A|1990-01-12|2000-06-13|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

US6673986B1|1990-01-12|2004-01-06|Abgenix, Inc.|Generation of xenogeneic antibodies|

---

US6255458B1|1990-08-29|2001-07-03|Genpharm International|High affinity human antibodies and human antibodies against digoxin|

---

US7041871B1|1995-10-10|2006-05-09|Genpharm International, Inc.|Transgenic non-human animals capable of producing heterologous antibodies|

---

US5770429A|1990-08-29|1998-06-23|Genpharm International, Inc.|Transgenic non-human animals capable of producing heterologous antibodies|

---

CA2161351C|1993-04-26|2010-12-21|Nils Lonberg|Transgenic non-human animals capable of producing heterologous antibodies|

---

CA2089661C†|1990-08-29|2007-04-03|Nils Lonberg|Transgenic non-human animals capable of producing heterologous antibodies|

---

US7067284B1|1992-01-27|2006-06-27|The Scripps Research Institute|Methods for producing antibody libraries using universal or randomized immunoglobulin light chains|

---

US5667988A|1992-01-27|1997-09-16|The Scripps Research Institute|Methods for producing antibody libraries using universal or randomized immunoglobulin light chains|

---

AT149570T|1992-08-17|1997-03-15|Genentech Inc|SPECIFIC IMMUNOADHESINE|

---

US5693506A|1993-11-16|1997-12-02|The Regents Of The University Of California|Process for protein production in plants|

---

US5827690A|1993-12-20|1998-10-27|Genzyme Transgenics Corporatiion|Transgenic production of antibodies in milk|

---

AT213771T|1993-12-23|2002-03-15|Infigen Inc|EMBRYONIC STEM CELLS OF HIP ANIMALS AS CORE DONATORS AND CORE TRANSFER TECHNIQUES FOR THE PRODUCTION OF CHIMERIC AND TRANSGENIC ANIMALS|

---

ES2247204T3|1994-01-31|2006-03-01|Trustees Of Boston University|BANKS OF POLYCLONAL ANTIBODIES.|

---

US7119248B1|1994-04-12|2006-10-10|Miltenyi Biotec Gmbh|Antibodies against epitopes with homology to self antigens, methods of preparation and applications thereof|

---

US6080560A|1994-07-25|2000-06-27|Monsanto Company|Method for producing antibodies in plant cells|

---

US5731168A|1995-03-01|1998-03-24|Genentech, Inc.|Method for making heteromultimeric polypeptides|

---

AT218143T|1996-09-03|2002-06-15|Gsf Forschungszentrum Umwelt|USE OF BI AND TRISPECIFIC ANTIBODIES FOR INDUCING TUMOR IMMUNITY|

---

US7084260B1|1996-10-10|2006-08-01|Genpharm International, Inc.|High affinity human antibodies and human antibodies against human antigens|

---

EP2305027B1|1996-12-03|2014-07-02|Amgen Fremont Inc.|Transgenic mammals having human Ig loci including plural VH and Vkappa regions and antibodies produced therefrom|

---

EP0973871A1|1997-03-06|2000-01-26|Infigen, Inc.|Method of cloning animals|

---

DE69800716T2|1997-04-14|2001-09-20|Micromet Ges Fuer Biomedizinis|NEW METHOD FOR PRODUCING ANTI-HUMAN ANTIGENT RECEPTORS AND THEIR USE|

---

US20020062010A1|1997-05-02|2002-05-23|Genentech, Inc.|Method for making multispecific antibodies having heteromultimeric and common components|

---

CA2288600C|1997-05-02|2010-06-01|Genentech, Inc.|A method for making multispecific antibodies having heteromultimeric and common components|

---

US6774279B2|1997-05-30|2004-08-10|Carnegie Institution Of Washington|Use of FLP recombinase in mice|

---

JP3992298B2|1997-10-03|2007-10-17|中外製薬株式会社|Natural humanized antibody|

---

ES2308327T3|1997-11-18|2008-12-01|Pioneer Hi-Bred International, Inc.|COMPOSITIONS AND METHODS FOR GENETIC MODIFICATION OF PLANTS.|

---

GB9823930D0|1998-11-03|1998-12-30|Babraham Inst|Murine expression of human ig locus|

---

US6914128B1|1999-03-25|2005-07-05|Abbott Gmbh & Co. Kg|Human antibodies that bind human IL-12 and methods for producing|

---

SI1533380T1|1999-04-15|2010-03-31|Crucell Holland Bv|Recombinant protein production in a human cell comprising at least one E1 protein of adenovirus|

---

AU4535801A|2000-02-29|2001-09-12|Univ Auburn|Production of antibodies in transgenic plastids|

---

RU2262511C2|2000-05-18|2005-10-20|Джапан Тобакко, Инк.|Humanized monoclonal antibody raised against ailim, co-stimulating molecule for signal transfer and its pharmaceutical applying|

---

CN1455817A|2000-07-21|2003-11-12|美利坚合众国|Methods for replacement, translocation and stacking of DNA in eukaryotic genomes|

---

US7129084B2|2000-08-03|2006-10-31|Therapeutic Human Polyclonals, Inc.|Production of humanized antibodies in transgenic animals|

---

EP1184458A1|2000-08-28|2002-03-06|U-BISys B.V.|Differentially expressed CD46 epitopes, proteinaceous molecules capable of binding thereto, and uses thereof|

---

US20020119148A1|2000-09-01|2002-08-29|Gerritsen Mary E.|ErbB4 antagonists|

---

US6596541B2†|2000-10-31|2003-07-22|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

US7105348B2|2000-10-31|2006-09-12|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

US6586251B2|2000-10-31|2003-07-01|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

SK287954B6|2001-01-05|2012-07-03|Pfizer Inc.|Human monoclonal antibody or antigen-binding portion thereof that specifically binds to IGF-IR, pharmaceutical composition comprising the antibody or antigen-binding portion thereof, isolated cell line producing the antibody, isolated nucleic acid molecule, vector, host cell, transgenic animal, method of making of antibody or antigen-binding portion thereof and use of the antibody and the isolated nucleic acid molecule|

---

US6961875B2|2001-03-22|2005-11-01|International Business Machines Corporation|Method and apparatus for capturing event traces for debug and analysis|

---

GB0110029D0|2001-04-24|2001-06-13|Grosveld Frank|Transgenic animal|

---

AT477280T|2001-06-28|2010-08-15|Domantis Ltd|DOUBLE-SPECIFIC LIGAND AND ITS USE|

---

JP2005538706A|2001-07-12|2005-12-22|ジェファーソン フーテ，|Super humanized antibody|

---

US20030138440A1|2001-07-19|2003-07-24|Fang Fang|Multimeric proteins and methods of making and using same|

---

EP1298207B2|2001-10-01|2015-12-30|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Methods of producing protein libraries and selection of proteins from them|

---

US20060199204A1|2001-10-05|2006-09-07|U.S. Epa|Genetic testing for male factor infertility|

---

WO2003031656A1|2001-10-05|2003-04-17|United States Environmental Protection Agency|Genetic testing for male factor infertility|

---

DK1461442T3|2001-11-30|2017-12-04|Amgen Fremont Inc|Transgenic animals with human Ig lambda light chain genes|

---

GB0130267D0|2001-12-19|2002-02-06|Neutec Pharma Plc|Focussed antibody technology|

---

US20050095712A1|2002-01-17|2005-05-05|Alberto Martin|Mutations caused by activation-induced cytidine deaminase|

---

JP2005527490A|2002-01-18|2005-09-15|イノヴィオアーエス|Bispecific antibody DNA constructs for intramuscular administration|

---

AU2003235833A1|2002-04-26|2003-11-10|Chugai Seiyaku Kabushiki Kaisha|Method of screening agonistic antibody|

---

CA2489467C|2002-06-14|2015-02-24|Immunomedics, Inc.|Humanized monoclonal antibody hpam4|

---

CN101962408A|2002-07-12|2011-02-02|杰斐逊·富特|Super-humanized antibody|

---

DK2314629T3|2002-07-18|2014-01-20|Merus B V|Recombinant preparation of mixtures of antibodies|

---

AR042145A1|2002-11-27|2005-06-08|Dow Agrociences Llc|IMMUNOGLOBULIN PRODUCTION IN PLANTS WITH A REDUCED FUCOCILATION|

---

GB0228210D0|2002-12-03|2003-01-08|Babraham Inst|Single chain antibodies|

---

GB0230203D0|2002-12-27|2003-02-05|Domantis Ltd|Fc fusion|

---

EP1439234A1|2003-01-08|2004-07-21|ARTEMIS Pharmaceuticals GmbH|Targeted transgenesis using the rosa26 locus|

---

US8337841B2|2003-01-21|2012-12-25|Chugai Seiyaku Kabushiki Kaisha|Methods of screening for antibody light chains|

---

US20060153826A1|2003-01-28|2006-07-13|Sylvain Arnould|Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof|

---

US20070009957A1|2003-03-04|2007-01-11|Alexion Pharmaceuticals, Inc.|Vectors used to create hybrid constant regions|

---

EP2395016A3|2003-05-30|2012-12-19|Merus B.V.|Design and use of paired variable regions of specific binding molecules|

---

EP1644417B1|2003-07-15|2014-04-30|Therapeutic Human Polyclonals, Inc.|Humanized immunoglobulin loci|

---

US20050153392A1|2003-08-11|2005-07-14|Roland Buelow|Transgenesis with humanized immunoglobulin loci|

---

WO2005038001A2|2003-10-14|2005-04-28|Therapeutic Human Polyclonals, Inc.|Improved transgenesis by sperm-mediated gene transfer|

---

CA2550551C|2004-01-16|2013-10-29|Regeneron Pharmaceuticals, Inc.|Fusion polypeptides capable of activating receptors|

---

CN1560081A|2004-02-17|2005-01-05|大连帝恩生物工程有限公司|Preparing human source monoclone antibody by mouse capable of producing human IgGl weight chain-k light chain and application thereof|

---

US7625549B2|2004-03-19|2009-12-01|Amgen Fremont Inc.|Determining the risk of human anti-human antibodies in transgenic mice|

---

CA2827654C|2004-10-19|2019-04-02|Regeneron Pharmaceuticals, Inc.|Method for generating an animal homozygous for a genetic modification|

---

EP1812065A4|2004-10-22|2009-09-02|Medimmune Inc|High affinity antibodies against hmgb1 and methods of use thereof|

---

WO2006047367A2|2004-10-22|2006-05-04|Therapeutic Human Polyclonals, Inc.|Suppression of endogenous immunoglubolin expression in non-human transgenic animals|

---

WO2006117699A2|2005-04-29|2006-11-09|Innate Pharma|Transgenic animals and methods of making recombinant antibodies|

---

EP1896578A4|2005-05-14|2008-11-05|Univ Fudan|Piggybac as a tool for genetic manipulation and analysis in vertebrates|

---

FR2888850B1|2005-07-22|2013-01-11|Pf Medicament|NOVEL ANTI-IGF-IR ANTIBODIES AND THEIR APPLICATIONS|

---

AU2006322445B2|2005-12-05|2011-05-12|Symphogen A/S|Anti-orthopoxvirus recombinant polyclonal antibody|

---

TWI404727B|2006-01-25|2013-08-11|Univ Erasmus Medical Ct|Allelic exclusion|

---

US7462759B2|2006-02-03|2008-12-09|Pioneer Hi-Bred International, Inc.|Brittle stalk 2 gene family and related methods and uses|

---

US7910798B2|2006-03-31|2011-03-22|Medarex, Inc.|Transgenic animals expressing chimeric antibodies for use in preparing human antibodies|

---

MY147468A|2006-06-02|2012-12-14|Regeneron Pharma|High affinity antibodies to human il-6 receptor|

---

JP2010501165A|2006-08-22|2010-01-21|ジーツーインフラメイションプロプライエタリーリミテッド|Antibody production method|

---

US7608693B2|2006-10-02|2009-10-27|Regeneron Pharmaceuticals, Inc.|High affinity human antibodies to human IL-4 receptor|

---

CA2664343C|2006-10-02|2016-04-26|Regeneron Pharmaceuticals, Inc.|High affinity human antibodies to human il-4 receptor|

---

RU2448979C2|2006-12-14|2012-04-27|Ридженерон Фармасьютикалз, Инк.|Human antibodies to delta-like human ligand-4|

---

GB0700194D0|2007-01-05|2007-02-14|Univ Edinburgh|Humanisation of animals|

---

EP2583551A1|2007-03-13|2013-04-24|National Jewish Health|Methods for generation of antibodies|

---

KR102096731B1|2007-06-01|2020-04-02|오픈 모노클로날 테크놀로지, 인코포레이티드|Compositions and methods for inhibiting endogenous immunoglobulin genes and producing transgenic human idiotype antibodies|

---

WO2009013620A2|2007-06-11|2009-01-29|Erasmus University Medical Center Rotterdam|Homologous recombination|

---

ITMI20071522A1|2007-07-27|2009-01-28|Areta Internat S R L|IDIOTYPIC VACCINE|

---

EP2185692A4|2007-08-10|2012-05-02|Medarex Inc|Hco32 and hco27 and related examples|

---

BRPI0815416A2|2007-08-15|2014-10-21|Amunix Inc|COMPOSITIONS AND METHODS FOR MODIFYING PROPERTIES OF BIOLOGICALLY ACTIVE POLYPEPTIDES|

---

MX2010002661A|2007-09-14|2010-05-20|Adimab Inc|Rationally designed, synthetic antibody libraries and uses therefor.|

---

WO2009051974A1|2007-10-17|2009-04-23|Nuvelo, Inc.|Antibodes to cll-1|

---

PL2222706T5|2007-12-14|2017-09-29|Novo Nordisk As|Antibodies against human nkg2d and uses thereof|

---

ES2563027T3|2008-01-07|2016-03-10|Amgen Inc.|Method for manufacturing antibody Fc heterodimer molecules using electrostatic conduction effects|

---

CA2721231C|2008-04-14|2015-10-06|Innovative Targeting Solutions Inc.|Sequence diversity generation in immunoglobulins|

---

US20110123527A1|2008-05-23|2011-05-26|Hiroaki Shizuya|Method of generating single vl domain antibodies in transgenic animals|

---

US20100069614A1|2008-06-27|2010-03-18|Merus B.V.|Antibody producing non-human mammals|

---

EP3456190B1|2008-06-27|2021-11-24|Merus N.V.|Antibody producing transgenic murine animal|

---

CA3038954A1|2008-09-30|2010-04-08|Ablexis, Llc|Non-human mammals for the production of chimeric antibodies|

---

DK2356270T3|2008-11-07|2016-12-12|Fabrus Llc|Combinatorial antibody libraries and uses thereof|

---

SG172176A1|2008-12-18|2011-07-28|Univ Erasmus Medical Ct|Non-human transgenic animals expressing humanised antibodies and use therof|

---

EP2401298A1|2009-02-24|2012-01-04|Glaxo Group Limited|Antigen-binding constructs|

---

RU2011149353A|2009-05-07|2013-06-20|Вольво Констракшн Эквипмент Аб|WORKING MACHINE AND METHOD FOR MANAGING ITS WORK|

---

CA2758356C|2009-05-29|2016-07-26|Morphosys Ag|A collection of vh and vl pairs having favourable biophysical properties and methods for its use|

---

KR101904065B1|2009-06-26|2018-10-04|리제너론 파마슈티칼스 인코포레이티드|Readily isolated bispecific antibodies with native immunoglobulin format|

---

EP2517557B1|2009-07-08|2016-04-13|Kymab Limited|Animal models and therapeutic molecules|

---

US20120204278A1|2009-07-08|2012-08-09|Kymab Limited|Animal models and therapeutic molecules|

---

WO2011158009A1|2010-06-17|2011-12-22|Kymab Limited|Animal models and therapeutic molecules|

---

AU2010320130B2|2009-11-17|2015-03-12|Sab, Llc|Human artificial chromosome vector|

---

LT2954779T|2009-12-10|2019-05-27|Regeneron Pharmaceuticals, Inc.|Mice that make heavy chain antibodies|

---

AU2013204140B2|2012-03-06|2016-01-28|Regeneron Pharmaceuticals, Inc.|Common light chain mouse|

---

KR102283195B1|2010-02-08|2021-07-29|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

RU2014153674A|2012-06-05|2016-07-27|Регенерон Фармасьютикалз, Инк.|METHOD FOR PRODUCING FULLY HUMAN BASSPECIFIC ANTIBODIES USING A GENERAL EASY LIGHT CHAIN|

---

US20130185821A1|2010-02-08|2013-07-18|Regeneron Pharmaceuticals, Inc.|Common Light Chain Mouse|

---

US20120021409A1|2010-02-08|2012-01-26|Regeneron Pharmaceuticals, Inc.|Common Light Chain Mouse|

---

US20130045492A1|2010-02-08|2013-02-21|Regeneron Pharmaceuticals, Inc.|Methods For Making Fully Human Bispecific Antibodies Using A Common Light Chain|

---

US9796788B2|2010-02-08|2017-10-24|Regeneron Pharmaceuticals, Inc.|Mice expressing a limited immunoglobulin light chain repertoire|

---

JP6529957B2|2013-03-13|2019-06-12|リジェネロン・ファーマシューティカルズ・インコーポレイテッドＲｅｇｅｎｅｒｏｎ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ．|Mice Expressing Limited Immunoglobulin Light Chain Repertoire|

---

KR20150126863A|2013-03-13|2015-11-13|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

CA2797981C|2010-05-14|2019-04-23|Rinat Neuroscience Corporation|Heterodimeric proteins and methods for producing and purifying them|

---

MY165287A|2010-06-22|2018-03-21|Regeneron Pharma|Mice expressing a light chain with human lambda variable and mouse constant regions|

---

WO2012018764A1|2010-08-02|2012-02-09|Regeneron Pharmaceuticals, Inc.|Mice that make binding proteins comprising vl domains|

---

ES2748832T3|2011-02-25|2020-03-18|Regeneron Pharma|ADAM6 mice|

---

HUE047278T2|2011-08-05|2020-04-28|Regeneron Pharma|Humanized universal light chain mice|

---

CA2791109C|2011-09-26|2021-02-16|Merus B.V.|Generation of binding molecules|

---

PL2627773T3|2011-10-17|2017-11-30|Regeneron Pharmaceuticals, Inc.|Restricted immunoglobulin heavy chain mice|

---

GB201122047D0|2011-12-21|2012-02-01|Kymab Ltd|Transgenic animals|

---

US20150196637A1|2012-04-20|2015-07-16|Merus B.V.|Methods and means for the production of ig-like molecules|US6596541B2|2000-10-31|2003-07-22|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

US20050144655A1|2000-10-31|2005-06-30|Economides Aris N.|Methods of modifying eukaryotic cells|

---

DK2314629T3|2002-07-18|2014-01-20|Merus B V|Recombinant preparation of mixtures of antibodies|

---

USRE47770E1|2002-07-18|2019-12-17|Merus N.V.|Recombinant production of mixtures of antibodies|

---

EP2395016A3|2003-05-30|2012-12-19|Merus B.V.|Design and use of paired variable regions of specific binding molecules|

---

ES2378407T3|2006-09-01|2012-04-12|Therapeutic Human Polyclonals, Inc.|Increased expression of human or humanized immunoglobulin in non-human transgenic animals|

---

EP3456190B1|2008-06-27|2021-11-24|Merus N.V.|Antibody producing transgenic murine animal|

---

US20100069614A1|2008-06-27|2010-03-18|Merus B.V.|Antibody producing non-human mammals|

---

US9676845B2|2009-06-16|2017-06-13|Hoffmann-La Roche, Inc.|Bispecific antigen binding proteins|

---

US20120204278A1|2009-07-08|2012-08-09|Kymab Limited|Animal models and therapeutic molecules|

---

EP2517557B1|2009-07-08|2016-04-13|Kymab Limited|Animal models and therapeutic molecules|

---

US9796788B2|2010-02-08|2017-10-24|Regeneron Pharmaceuticals, Inc.|Mice expressing a limited immunoglobulin light chain repertoire|

---

KR20150126863A|2013-03-13|2015-11-13|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

US20120021409A1|2010-02-08|2012-01-26|Regeneron Pharmaceuticals, Inc.|Common Light Chain Mouse|

---

JP6529957B2|2013-03-13|2019-06-12|リジェネロン・ファーマシューティカルズ・インコーポレイテッドＲｅｇｅｎｅｒｏｎ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ．|Mice Expressing Limited Immunoglobulin Light Chain Repertoire|

---

US20130045492A1|2010-02-08|2013-02-21|Regeneron Pharmaceuticals, Inc.|Methods For Making Fully Human Bispecific Antibodies Using A Common Light Chain|

---

RU2014153674A|2012-06-05|2016-07-27|Регенерон Фармасьютикалз, Инк.|METHOD FOR PRODUCING FULLY HUMAN BASSPECIFIC ANTIBODIES USING A GENERAL EASY LIGHT CHAIN|

---

AU2013204140B2|2012-03-06|2016-01-28|Regeneron Pharmaceuticals, Inc.|Common light chain mouse|

---

KR102283195B1|2010-02-08|2021-07-29|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

MY165287A|2010-06-22|2018-03-21|Regeneron Pharma|Mice expressing a light chain with human lambda variable and mouse constant regions|

---

WO2012018764A1|2010-08-02|2012-02-09|Regeneron Pharmaceuticals, Inc.|Mice that make binding proteins comprising vl domains|

---

CN103348012B|2010-11-27|2016-06-08|朱坚|A kind of humanized transgenic animals|

---

ES2748832T3|2011-02-25|2020-03-18|Regeneron Pharma|ADAM6 mice|

---

WO2012116927A1|2011-02-28|2012-09-07|F. Hoffmann-La Roche Ag|Monovalent antigen binding proteins|

---

EP2681239B8|2011-02-28|2015-09-09|F. Hoffmann-La Roche AG|Antigen binding proteins|

---

HUE047278T2|2011-08-05|2020-04-28|Regeneron Pharma|Humanized universal light chain mice|

---

EP3128009B1|2011-09-19|2020-07-29|Kymab Limited|Antibodies, variable domains & chains tailored for human use|

---

WO2013041845A2|2011-09-19|2013-03-28|Kymab Limited|Animals, repertoires & methods|

---

EP2761008A1|2011-09-26|2014-08-06|Kymab Limited|Chimaeric surrogate light chainscomprising human vpreb|

---

CA2791109C|2011-09-26|2021-02-16|Merus B.V.|Generation of binding molecules|

---

GB2495083A|2011-09-26|2013-04-03|Kymab Ltd|Human VpreB and chimaeric surrogate light chains in transgenic non-human vertebrates|

---

RS55822B1|2011-09-30|2017-08-31|Dana-Farber Cancer Institute Inc|Therapeutic peptides|

---

PL2627773T3|2011-10-17|2017-11-30|Regeneron Pharmaceuticals, Inc.|Restricted immunoglobulin heavy chain mice|

---

WO2013063391A2|2011-10-28|2013-05-02|Trianni, Inc.|Transgenic animals and methods of use|

---

CN108464278B|2013-03-11|2021-05-04|瑞泽恩制药公司|Transgenic mice expressing chimeric Major Histocompatibility Complexclass II molecules|

---

MX356429B|2011-12-20|2018-05-29|Regeneron Pharma|Humanized light chain mice.|

---

KR20140130709A|2012-03-02|2014-11-11|리제너론 파마슈티칼스 인코포레이티드|Human antibodies to clostridium difficile toxins|

---

CN105722387B|2013-09-18|2020-01-17|瑞泽恩制药公司|Histidine engineered light chain antibodies and genetically modified non-human animals for production thereof|

---

EP2825037B1|2012-03-16|2019-05-01|Regeneron Pharmaceuticals, Inc.|Rodents expressing ph-sensitive immunoglobulin sequences|

---

CA2865644A1|2012-03-16|2013-09-19|Regeneron Pharmaceuticals, Inc.|Mice that produce antigen-binding proteins with ph-dependent binding characteristics|

---

ES2849349T3|2012-03-16|2021-08-17|Regeneron Pharma|Histidine Engineered Light Chain Antibodies and Genetically Modified Rodents for Generation|

---

AU2015227453B2|2012-03-16|2017-05-25|Regeneron Pharmaceuticals, Inc.|Non-human animals expressing ph-sensitive immunoglobulin sequences|

---

US20140013456A1|2012-03-16|2014-01-09|Regeneron Pharmaceuticals, Inc.|Histidine Engineered Light Chain Antibodies and Genetically Modified Non-Human Animals for Generating the Same|

---

US10251377B2|2012-03-28|2019-04-09|Kymab Limited|Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies|

---

US9445581B2|2012-03-28|2016-09-20|Kymab Limited|Animal models and therapeutic molecules|

---

US9253965B2|2012-03-28|2016-02-09|Kymab Limited|Animal models and therapeutic molecules|

---

US20150196637A1|2012-04-20|2015-07-16|Merus B.V.|Methods and means for the production of ig-like molecules|

---

AU2013259276B2|2012-05-10|2018-03-22|Bioatla Llc|Multi-specific monoclonal antibodies|

---

GB2502127A|2012-05-17|2013-11-20|Kymab Ltd|Multivalent antibodies and in vivo methods for their production|

---

KR102266274B1|2012-06-12|2021-06-17|리제너론 파마슈티칼스 인코포레이티드|Humanized non-human animals with restricted immunoglobulin heavy chain loci|

---

WO2014022540A1|2012-08-02|2014-02-06|Regeneron Pharmaceuticals, Inc.|Multivalent antigen-binding proteins|

---

JO3462B1|2012-08-22|2020-07-05|Regeneron Pharma|Human Antibodies to GFR?3 and methods of use thereof|

---

JOP20200236A1|2012-09-21|2017-06-16|Regeneron Pharma|Anti-cd3 antibodies, bispecific antigen-binding molecules that bind cd3 and cd20, and uses thereof|

---

EP2900694B1|2012-09-27|2018-09-12|Merus N.V.|Bispecific igg antibodies as t cell engagers|

---

RU2017114166A|2013-02-20|2019-01-29|Регенерон Фармасьютикалс, Инк.|NON-HUMAN ANIMALS WITH MODIFIED SEQUENCES OF HEAVY IMMUNOGLOBULIN CHAINS|

---

ES2736052T3|2013-02-20|2019-12-23|Regeneron Pharma|Mice expressing humanized T-cell co-receptors|

---

KR102211267B1|2013-02-22|2021-02-04|리제너론 파아마슈티컬스, 인크.|Mice expressing humanized major histocompatibility complex|

---

WO2014141189A1|2013-03-14|2014-09-18|Erasmus University Medical Center|Transgenic non-human mammal for antibody production|

---

US9788534B2|2013-03-18|2017-10-17|Kymab Limited|Animal models and therapeutic molecules|

---

KR102049990B1|2013-03-28|2019-12-03|삼성전자주식회사|Fusion protein comprising anti-c-Met antibody and VEGF binding fragment|

---

MY172430A|2013-04-29|2019-11-25|Hoffmann La Roche|Human fcrn-binding modified antibodies and methods of use|

---

US20150033372A1|2013-05-01|2015-01-29|Kymab Limited|Human VpreB & Chimaeric Surrogate Light Chains in Transgenic Non-Human Vertebrates|

---

US9783618B2|2013-05-01|2017-10-10|Kymab Limited|Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics|

---

US9783593B2|2013-05-02|2017-10-10|Kymab Limited|Antibodies, variable domains and chains tailored for human use|

---

US10501737B2|2013-09-30|2019-12-10|Chugai Seiyaku Kabushiki Kaisha|Method for producing antigen-binding molecule using modified helper phage|

---

AU2014330922A1|2013-10-01|2016-03-03|Kymab Limited|Animal models and therapeutic molecules|

---

WO2015052230A1|2013-10-11|2015-04-16|F. Hoffmann-La Roche Ag|Multispecific domain exchanged common variable light chain antibodies|

---

WO2015107026A1|2014-01-15|2015-07-23|F. Hoffmann-La Roche Ag|Fc-region variants with modified fcrn- and maintained protein a-binding properties|

---

TWI681969B|2014-01-23|2020-01-11|美商再生元醫藥公司|Human antibodies to pd-1|

---

TWI680138B|2014-01-23|2019-12-21|美商再生元醫藥公司|Human antibodies to pd-l1|

---

US10844127B2|2014-02-28|2020-11-24|Merus N.V.|Antibodies that bind EGFR and ErbB3|

---

TWI701042B|2014-03-19|2020-08-11|美商再生元醫藥公司|Methods and antibody compositions for tumor treatment|

---

RU2016141307A3|2014-03-21|2018-10-24|

---

KR20160131118A|2014-03-21|2016-11-15|리제너론 파마슈티칼스 인코포레이티드|Vl antigen binding proteins exhibiting distinct binding characteristics|

---

PE20170261A1|2014-05-13|2017-04-12|Univ Pennsylvania|COMPOSITIONS THAT INCLUDE ADENO-ASSOCIATED VIRUSTHAT EXPRESSES DUAL ANTIBODY CONSTRUCTS AND THEIR USES|

---

PT3151921T|2014-06-06|2019-11-21|Squibb Bristol Myers Co|Antibodies against glucocorticoid-induced tumor necrosis factor receptorand uses thereof|

---

MX2017003640A|2014-09-19|2017-10-31|Regeneron Pharma|Chimeric antigen receptors.|

---

WO2016054598A2|2014-10-03|2016-04-07|Massachusetts Institute Of Technology|Antibodies that bind ebola glycoprotein and uses thereof|

---

MX2017005150A|2014-11-06|2017-08-08|F Hoffmann-La Roche Ag|Fc-region variants with modified fcrn- and protein a-binding properties.|

---

KR20170089881A|2014-11-17|2017-08-04|리제너론 파아마슈티컬스, 인크.|Methods for tumor treatment using cd3xcd20 bispecific antibody|

---

MX2017006624A|2014-11-21|2017-08-21|Bristol-Myers Squibb Company|Antibodies against cd73 and uses thereof.|

---

TWI701258B|2014-12-19|2020-08-11|美商再生元醫藥公司|Human antibodies to influenza hemagglutinin|

---

JP6738348B2|2014-12-19|2020-08-12|リジェネサンス ベスローテン フェンノートシャップ|Antibodies that bind to human C6 and uses thereof|

---

US11111314B2|2015-03-19|2021-09-07|Regeneron Pharmaceuticals, Inc.|Non-human animals that select for light chain variable regions that bind antigen|

---

SG10202008304TA|2015-05-29|2020-10-29|Squibb Bristol Myers Co|Antibodies against ox40 and uses thereof|

---

MX2017016502A|2015-06-29|2018-03-12|Univ Rockefeller|Antibodies to cd40 with enhanced agonist activity.|

---

CN107849131A|2015-07-06|2018-03-27|瑞泽恩制药公司|Polyspecific antigen binding molecules and application thereof|

---

CN108026174A|2015-07-10|2018-05-11|美勒斯公司|People's CD3 binding antibodies|

---

TWI728990B|2015-07-31|2021-06-01|美商再生元醫藥公司|Anti-psma antibodies, bispecific antigen-binding molecules that bind psma and cd3, and uses thereof|

---

TW201726713A|2015-09-23|2017-08-01|再生元醫藥公司|Optimized anti-CD3 bispecific antibodies and uses thereof|

---

KR20180070604A|2015-10-09|2018-06-26|리제너론 파마슈티칼스 인코포레이티드|Anti-LAG3 antibody and its use|

---

JP6983776B2|2015-11-19|2021-12-17|ブリストル−マイヤーズ スクイブ カンパニーBristol−Myers Squibb Company|Antibodies to Glucocorticoid-Induced Tumor Necrosis Factor Receptorand Their Use|

---

SG10201914034WA|2016-01-13|2020-03-30|Regeneron Pharma|Rodents having an engineered heavy chain diversity region|

---

CA3016534A1|2016-03-04|2017-09-08|The Rockefeller University|Antibodies to cd40 with enhanced agonist activity|

---

EA201891983A8|2016-03-04|2020-05-28|Бристол-Майерс Сквибб Компани|COMBINED THERAPY BY ANTIBODIES TO CD73|

---

US10968279B2|2016-05-09|2021-04-06|Bristol-Myers Squibb Company|TL1A antibodies and uses thereof|

---

TW201808330A|2016-05-13|2018-03-16|再生元醫藥公司|Methods of treating skin cancer by administering a PD-1 inhibitor|

---

SG11201809552SA|2016-05-20|2018-11-29|Regeneron Pharma|Methods for breaking immunological tolerance using multiple guide rnas|

---

CN113907043A|2016-06-03|2022-01-11|瑞泽恩制药公司|Non-human animals expressing exogenous terminal deoxynucleotidyl transferase|

---

WO2017218515A1|2016-06-14|2017-12-21|Regeneron Pharmaceuticals, Inc.|Anti-c5 antibodies and uses thereof|

---

BR112018076767A2|2016-06-21|2019-04-02|Teneobio, Inc.|cd3 binding antibodies|

---

US10077306B2|2016-07-14|2018-09-18|Bristol-Myers Squibb Company|Antibodies against TIM3 and uses thereof|

---

MX2019002307A|2016-08-26|2019-07-04|Sanofi Sa|Multispecific antibodies facilitating selective light chain pairing.|

---

WO2018044970A1|2016-08-31|2018-03-08|University Of Rochester|Human monoclonal antibodies to human endogenous retrovirus k envelopeand uses thereof|

---

KR20190052048A|2016-09-14|2019-05-15|테네오바이오, 인코포레이티드|CD3 binding antibody|

---

MA46281A|2016-09-23|2019-07-31|Regeneron Pharma|ANTI-MUC16 ANTIBODY |

---

MX2019003325A|2016-09-23|2019-08-05|Regeneron Pharma|Anti-steap2 antibodies, antibody-drug conjugates, and bispecific antigen-binding molecules that bind steap2 and cd3, and uses thereof.|

---

CU20200105A7|2016-10-13|2021-08-06|Massachusetts Inst Technology|ANTIBODIES THAT BIND THE ZIKA VIRUS ENVELOPE PROTEIN|

---

BR112019016336A2|2017-02-10|2020-03-31|Regeneron Pharmaceuticals, Inc.|RADIORROTULATED ANTIBODY CONJUGATE, METHOD FOR IMAGING A FABRIC EXPRESSING LAG3 AND TO TREAT A TUMOR, AND, COMPOUND.|

---

MX2019009117A|2017-02-17|2019-09-13|Squibb Bristol Myers Co|Antibodies to alpha-synuclein and uses thereof.|

---

EP3589650A1|2017-03-02|2020-01-08|Novartis AG|Engineered heterodimeric proteins|

---

TW201843173A|2017-04-07|2018-12-16|美商必治妥美雅史谷比公司|Anti-icos agonist antibodies and uses thereof|

---

TW201919582A|2017-07-24|2019-06-01|美商再生元醫藥公司|Stabilized antibody compositions and methods of producing same|

---

CN111148758A|2017-09-29|2020-05-12|瑞泽恩制药公司|Bispecific antigen binding molecules that bind to staphylococcal target antigens and complement components and uses thereof|

---

JP2021511026A|2018-01-12|2021-05-06|ブリストル−マイヤーズ スクイブ カンパニーＢｒｉｓｔｏｌ−Ｍｙｅｒｓ Ｓｑｕｉｂｂ Ｃｏｍｐａｎｙ|Antibodies to TIM3 and its use|

---

CA3093407A1|2018-03-23|2019-09-26|Bristol-Myers Squibb Company|Antibodies against mica and/or micb and uses thereof|

---

CA3093995A1|2018-03-24|2019-10-03|Regeneron Pharmaceuticals, Inc.|Genetically modified non-human animals for generating therapeutic antibodies against peptide-mhc complexes, methods of making and uses thereof|

---

JP2021523100A|2018-04-30|2021-09-02|リジェネロン・ファーマシューティカルズ・インコーポレイテッドＲｅｇｅｎｅｒｏｎ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ．|Antibodies and bispecific antigen-binding molecules that bind to HER2 and / or APPL2, and their conjugates and uses.|

---

CN112135624A|2018-05-17|2020-12-25|瑞泽恩制药公司|anti-CD 63 antibodies, conjugates, and uses thereof|

---

CA3103646A1|2018-06-14|2019-12-19|Regeneron Pharmaceuticals, Inc.|Non-human animals capable of engineered dh-dh rearrangement and uses thereof|

---

CN112351820A|2018-06-21|2021-02-09|瑞泽恩制药公司|Bispecific anti-PSMA X anti-CD 28 antibodies and uses thereof|

---

TW202019966A|2018-07-19|2020-06-01|美商再生元醫藥公司|BISPECIFIC ANTI-BCMAxANTI-CD3 ANTIBODIES AND USES THEREOF|

---

AU2019325565A1|2018-08-23|2021-03-11|Regeneron Pharmaceuticals, Inc.|Anti-Fc epsilon-R1 alphaantibodies, bispecific antigen-binding molecules that bind FceR1a and CD3, and uses thereof|

---

WO2020047389A1|2018-08-31|2020-03-05|Regeneron Pharmaceuticals, Inc.|Dosing strategy that mitigates cytokine release syndrome for cd3/c20 bispecific antibodies|

---

KR20210082207A|2018-10-23|2021-07-02|리제너론 파아마슈티컬스, 인크.|Anti-NPR1 antibodies and uses thereof|

---

TW202033555A|2018-11-16|2020-09-16|美商必治妥美雅史谷比公司|Anti-nkg2a antibodies and uses thereof|

---

JP2022507836A|2018-11-20|2022-01-18|タケダ ワクチン，インコーポレイテッド|New anti-Zika virus antibody and its use|

---

CN113166268A|2018-12-19|2021-07-23|瑞泽恩制药公司|Bispecific anti-MUC 16X anti-CD 28 antibodies and uses thereof|

---

CN113164598A|2018-12-19|2021-07-23|里珍纳龙药品有限公司|Bispecific anti-CD 28X anti-CD 22 antibodies and uses thereof|

---

US11008395B2|2019-01-22|2021-05-18|Bristol Myers-Squibb Company|Antibodies against IL-7R alpha subunit and uses thereof|

---

CA3127153A1|2019-02-22|2020-08-27|Regeneron Pharmaceuticals, Inc.|Rodents having genetically modified sodium channels and methods of use thereof|

---

US20200299388A1|2019-03-22|2020-09-24|Regeneron Pharmaceuticals, Inc.|EGFR x CD28 MULTISPECIFIC ANTIBODIES|

---

SG11202111258TA|2019-06-05|2021-11-29|Regeneron Pharma|Non-human animals having a limited lambda light chain repertoire expressed from the kappa locus and uses thereof|

---

CN114025802A|2019-06-21|2022-02-08|瑞泽恩制药公司|Use of bispecific antigen binding molecules that bind PSMA and CD3 in combination with 4-1BB co-stimulation|

---

CN113993547A|2019-06-21|2022-01-28|瑞泽恩制药公司|Use of bispecific antigen binding molecules that bind MUC16 and CD3 in combination with 4-1BB co-stimulation|

---

TW202120556A|2019-08-08|2021-06-01|美商再生元醫藥公司|Novel antigen binding molecule formats|

---

US20210047438A1|2019-08-15|2021-02-18|Regeneron Pharmaceuticals, Inc.|Multispecific Antigen-Binding Molecules for Cell Targeting and Uses Thereof|

---

GB201912008D0|2019-08-21|2019-10-02|Cambridge Entpr Ltd|Antibody|

---

WO2021113297A1|2019-12-02|2021-06-10|Regeneron Pharmaceuticals, Inc.|Peptide-mhc ii protein constructs and uses thereof|

---

US20210206865A1|2019-12-06|2021-07-08|Regeneron Pharmaceuticals, Inc.|Methods of Treating Multiple Myeloma with Bispecific Anti-BCMA x Anti-CD3 Antibodies|

---

US20210253716A1|2020-02-11|2021-08-19|Regeneron Pharmaceuticals, Inc.|Anti-acvr1 antibodies and uses thereof|

---

US11186639B2|2020-04-29|2021-11-30|Teneoone, Inc.|Multispecific heavy chain antibodies with modified heavy chain constant regions|

---

US20210355227A1|2020-05-12|2021-11-18|Regeneron Pharmaceuticals, Inc.|Anti-glp1r antagonist antibodies and methods of use thereof|

---

WO2021231732A1|2020-05-15|2021-11-18|Bristol-Myers Squibb Company|Antibodies to garp|

---

WO2021244522A1|2020-06-02|2021-12-09|Biocytogen PharmaceuticalsCo., Ltd.|Genetically modified non-human animals with common light chain immunoglobulin locus|

---

WO2022040482A1|2020-08-19|2022-02-24|Xencor, Inc.|Anti-cd28 and/or anti-b7h3 compositions|

法律状态:
2018-03-06| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-10-01| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2020-07-21| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2020-12-15| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2020-12-22| B06H| Technical and formal requirements: requirement cancelled [chapter 6.8 patent gazette]|Free format text: ANULADA A PUBLICACAO CODIGO 6.21 NA RPI NO 2606 DE 15/12/2020 POR TER SIDO INDEVIDA. |

---

2020-12-29| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-04-06| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-06-08| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 08/02/2011, OBSERVADAS AS CONDICOES LEGAIS. PATENTE CONCEDIDA CONFORME ADI 5.529/DF |

优先权:

---

申请号 | 申请日 | 专利标题

---

US30228210P| true| 2010-02-08|2010-02-08|

---

US61/302,282|2010-02-08|

---

PCT/US2011/023971|WO2011097603A1|2010-02-08|2011-02-08|Common light chain mouse|BR122014002928A| BR122014002928A2|2010-02-08|2011-02-08|methods of producing a mouse and an antibody and of selecting a human heavy chain variable region for the production of an antigen binding protein, use of a genetically modified mouse in the production of an antigen binding protein as well as chimeric antibody and hybridoma|